WormBase Tree Display for Variation: WBVar00143414
expand all nodes | collapse all nodes | view schema
| WBVar00143414 | Evidence | Paper_evidence | WBPaper00005913 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Accession_evidence | AJ505904 | ||||||||
| Name | Public_name | e698 | |||||||
| Other_name (17) | |||||||||
| HGVSg | CHROMOSOME_I:g.11770152G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | ZK1151 | |||||
| Flanking_sequences | tctcgagagcattggcgagagaagttggtg | aagcttcatgatcttctccttgatgagctt | |||||||
| Mapping_target | ZK1151 | ||||||||
| Type_of_mutation | Substitution | g | a | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004199 | ||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006876 | |||||||
| Transcript (11) | |||||||||
| Interactor (16) | |||||||||
| Genetics | Interpolated_map_position | I | 9.61491 | ||||||
| Mapping_data | In_2_point | 646 | |||||||
| 647 | |||||||||
| In_multi_point (2) | |||||||||
| Description | Phenotype (8) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001013 | Paper_evidence | WBPaper00031865 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals did not have altered susceptibility to P. aeruginosa at 15C or 25C. | Paper_evidence | WBPaper00031865 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Animals were exposed to P. aeruginosa starting at L4 stage. | Paper_evidence | WBPaper00031865 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature | 25 | Paper_evidence | WBPaper00031865 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00038193 | ||||||||
| WBPaper00040080 | |||||||||
| WBPaper00001328 | |||||||||
| WBPaper00031865 | |||||||||
| WBPaper00011329 | |||||||||
| WBPaper00046146 | |||||||||
| Method | Substitution_allele |
