WormBase Tree Display for Variation: WBVar00143414
expand all nodes | collapse all nodes | view schema
WBVar00143414 | Evidence (2) | |||||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e698 | ||||||
Other_name (17) | ||||||||
HGVSg | CHROMOSOME_I:g.11770152G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK1151 | ||||
Flanking_sequences | tctcgagagcattggcgagagaagttggtg | aagcttcatgatcttctccttgatgagctt | ||||||
Mapping_target | ZK1151 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004199 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006876 | ||||||
Transcript (11) | ||||||||
Interactor (16) | ||||||||
Genetics | Interpolated_map_position | I | 9.61491 | |||||
Mapping_data | In_2_point | 646 | ||||||
647 | ||||||||
In_multi_point | 566 | |||||||
567 | ||||||||
Description | Phenotype | WBPhenotype:0000030 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | generally poor growth | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | 50% | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000071 | Paper_evidence | WBPaper00040080 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000474 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mua (defective muscle attachment). | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | 50% | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001099 | Paper_evidence | WBPaper00038193 | ||||||
Curator_confirmed | WBPerson351 | |||||||
Remark | adults have a twisted nose | Paper_evidence | WBPaper00038193 | |||||
Curator_confirmed | WBPerson351 | |||||||
WBPhenotype:0001294 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | degenerate head, bent dorsally or ventrally; penetrance 50%; scoring easy to difficult (ES3/1). | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | 50% | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001297 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | adult male tail invariably thin fan and rays reduced in size | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | 50% | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00046146 | ||||||
Curator_confirmed | WBPerson12329 | |||||||
WBPhenotype:0002534 | Paper_evidence | WBPaper00031865 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited significanlty less activation of lys-8, clec-85, dod-22, F55G11.7 and K08D8.5 and higher activation of abf-1 and abf-3 gene expression compared to wild-type animals as determined by qPCR. | Paper_evidence | WBPaper00031865 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed (2) | ||||||||
Reference | WBPaper00038193 | |||||||
WBPaper00040080 | ||||||||
WBPaper00001328 | ||||||||
WBPaper00031865 | ||||||||
WBPaper00011329 | ||||||||
WBPaper00046146 | ||||||||
Method | Substitution_allele |