WormBase Tree Display for Variation: WBVar00143277
expand all nodes | collapse all nodes | view schema
WBVar00143277 | Evidence | Person_evidence | WBPerson10095 | ||
---|---|---|---|---|---|
Name | Public_name | e527 | |||
Other_name | CE11540:p.Gly246Glu | ||||
F59E12.2.1:c.1310+336C>T | |||||
F59E12.12.1:c.737G>A | |||||
HGVSg | CHROMOSOME_II:g.5651638C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F59E12 | |
Flanking_sequences | gttccaggcagcccgtcaggtcctggtaat | ctggaggtcccggacttcctggaggccctt | |||
Mapping_target | F59E12 | ||||
Type_of_mutation | Substitution | c | t | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00051519 | ||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene (2) | ||||
Transcript (2) | |||||
Genetics | Interpolated_map_position | II | -0.988732 | ||
Remark | Variation information submitted by WBPerson10095 on 2022-02-17_15:15:25 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). | Curator_confirmed | WBPerson51134 | ||
alt_det = g to a mut_det = G246E | Person_evidence | WBPerson10095 | |||
Curator_confirmed | WBPerson51134 | ||||
Method | Substitution_allele |