WormBase Tree Display for Variation: WBVar00143186
expand all nodes | collapse all nodes | view schema
WBVar00143186 | Evidence | Person_evidence | WBPerson39 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e407 | ||||||
Other_name (21) | ||||||||
HGVSg | CHROMOSOME_III:g.10524298C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | T21C12 | ||||
Flanking_sequences | atggacctgaagctgttcccaatggactct | aacactgtaaactggaaattgaaagctgta | ||||||
Mapping_target | T21C12 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003576 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (19) | ||||||||
Component_of_genotype | WBGenotype00000119 | |||||||
Laboratory (2) | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006784 | ||||||
Transcript (11) | ||||||||
Interactor | WBInteraction000501251 | |||||||
WBInteraction000501252 | ||||||||
Genetics | Interpolated_map_position | III | 3.30012 | |||||
Description | Phenotype | WBPhenotype:0000010 | Paper_evidence | WBPaper00036766 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | unc-25 mutants were hypersensitive to fluoxetine in the paralysis assay. | Paper_evidence | WBPaper00036766 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00005058 | Paper_evidence | WBPaper00036766 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000153 | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed shortening to ~85% of original body length upon photoactivation of ChR2-YFP. | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay (2) | ||||||||
WBPhenotype:0000273 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit reduced thrashing compared to wild type animals. | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000563 | Paper_evidence | WBPaper00003576 | ||||||
Person_evidence | WBPerson39 | |||||||
Curator_confirmed | WBPerson48 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00003576 | |||||
Person_evidence | WBPerson39 | |||||||
Curator_confirmed | WBPerson48 | |||||||
Recessive | Paper_evidence | WBPaper00003576 | ||||||
Person_evidence | WBPerson39 | |||||||
Curator_confirmed | WBPerson48 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00003576 | |||||
Person_evidence | WBPerson39 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00055158 | ||||||
Curator_confirmed | WBPerson8908 | |||||||
Remark | Pentylenetetrazol-induced convulsions seen with these alleles | Paper_evidence | WBPaper00055158 | |||||
Curator_confirmed | WBPerson8908 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00055158 | |||||
Curator_confirmed | WBPerson8908 | |||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00055158 | ||||
Curator_confirmed | WBPerson8908 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00055158 | ||||
Curator_confirmed | WBPerson8908 | |||||||
WBPhenotype:0001316 | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Light-evoked currents (photo-ePSCs) were abolished. | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay (2) | ||||||||
WBPhenotype:0001701 | Paper_evidence | WBPaper00060194 | ||||||
Curator_confirmed | WBPerson8908 | |||||||
Remark | Exhibits pentylenetetrazol-induced head bobbing convulsions | Paper_evidence | WBPaper00060194 | |||||
Curator_confirmed | WBPerson8908 | |||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00060194 | ||||
Curator_confirmed | WBPerson8908 | |||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Expression of ChR2-YFP in cholinergic neurons was not affected. | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | zxIs6 | Paper_evidence | WBPaper00032190 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000567 | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dorsal coiling was not triggered in animals treated to photostimulation of ChR2-YFP in cholinergic neurons. | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay (2) | ||||||||
Disease_info | Models_disease | DOID:1826 | ||||||
Models_disease_in_annotation | WBDOannot00001202 | |||||||
WBDOannot00001203 | ||||||||
Reference | WBPaper00035198 | |||||||
WBPaper00036766 | ||||||||
WBPaper00032190 | ||||||||
WBPaper00003576 | ||||||||
WBPaper00055158 | ||||||||
WBPaper00061172 | ||||||||
WBPaper00060194 | ||||||||
WBPaper00064917 | ||||||||
WBPaper00065359 | ||||||||
WBPaper00066029 | ||||||||
Remark | affects all UNC-49B subunits | |||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |