WormBase Tree Display for Variation: WBVar00143186
expand all nodes | collapse all nodes | view schema
WBVar00143186 | Evidence | Person_evidence | WBPerson39 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | T21C12 | |||
Flanking_sequences | atggacctgaagctgttcccaatggactct | aacactgtaaactggaaattgaaagctgta | |||||
Mapping_target | T21C12 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003576 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (19) | |||||||
Component_of_genotype | WBGenotype00000119 | ||||||
Laboratory | CB | ||||||
KP | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006784 | |||||
Transcript (11) | |||||||
Interactor | WBInteraction000501251 | ||||||
WBInteraction000501252 | |||||||
Genetics | Interpolated_map_position | III | 3.30012 | ||||
Description (2) | |||||||
Disease_info | Models_disease | DOID:1826 | |||||
Models_disease_in_annotation | WBDOannot00001202 | ||||||
WBDOannot00001203 | |||||||
Reference | WBPaper00035198 | ||||||
WBPaper00036766 | |||||||
WBPaper00032190 | |||||||
WBPaper00003576 | |||||||
WBPaper00055158 | |||||||
WBPaper00061172 | |||||||
WBPaper00060194 | |||||||
WBPaper00064917 | |||||||
WBPaper00065359 | |||||||
WBPaper00066029 | |||||||
Remark | affects all UNC-49B subunits | ||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
Method | Substitution_allele |