WormBase Tree Display for Variation: WBVar00143133
expand all nodes | collapse all nodes | view schema
WBVar00143133 | Evidence | Paper_evidence | WBPaper00004275 | ||
---|---|---|---|---|---|
Name | Public_name | e345 | |||
Other_name | JC8.10b.1:c.547_839+1del | ||||
JC8.10a.1:c.547_839+1del | |||||
JC8.10d.1:c.547_839+1del | |||||
JC8.10c.1:c.547_839+1del | |||||
HGVSg | CHROMOSOME_IV:g.13269114_13269407del | ||||
Sequence_details | SMap | S_parent | Sequence | Y67H2A | |
Flanking_sequences | cataatttttcacacctatttttttccaga | taattttactgtatttaagggatttttctt | |||
Mapping_target | Y67H2A | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin (4) | |||||
Affects | Gene | WBGene00006763 | |||
Transcript | JC8.10b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant | ||
VEP_impact | HIGH | ||||
HGVSc | JC8.10b.1:c.547_839+1del | ||||
cDNA_position | 552-? | ||||
CDS_position | 547-? | ||||
Protein_position | 183-? | ||||
Intron_number | 5/11 | ||||
Exon_number | 5/12 | ||||
JC8.10c.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant | |||
VEP_impact | HIGH | ||||
HGVSc | JC8.10c.1:c.547_839+1del | ||||
cDNA_position | 550-? | ||||
CDS_position | 547-? | ||||
Protein_position | 183-? | ||||
Intron_number | 5/6 | ||||
Exon_number | 5/7 | ||||
JC8.10d.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant | |||
VEP_impact | HIGH | ||||
HGVSc | JC8.10d.1:c.547_839+1del | ||||
cDNA_position | 547-? | ||||
CDS_position | 547-? | ||||
Protein_position | 183-? | ||||
Intron_number | 4/6 | ||||
Exon_number | 4/7 | ||||
JC8.10a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant | |||
VEP_impact | HIGH | ||||
HGVSc | JC8.10a.1:c.547_839+1del | ||||
cDNA_position | 550-? | ||||
CDS_position | 547-? | ||||
Protein_position | 183-? | ||||
Intron_number | 5/10 | ||||
Exon_number | 5/11 | ||||
Genetics | Interpolated_map_position | IV | 8.5142 | ||
Mapping_data | In_2_point | 21 | |||
142 | |||||
In_multi_point (13) | |||||
In_pos_neg_data | 976 | ||||
983 | |||||
3812 | |||||
8180 | |||||
Description | Phenotype (4) | ||||
Reference | WBPaper00004275 | ||||
WBPaper00013791 | |||||
Remark | The in-frame deletion removes the complete 4th exon. The flanking sequeneces are 30 bp to the left of S(183) and 30 bp to the right of R(280) | Curator_confirmed | WBPerson1845 | ||
e345 is an in-frame deletion of aa 183-280 | Paper_evidence | WBPaper00004275 | |||
Method | Deletion_allele |