WormBase Tree Display for Variation: WBVar00143075
expand all nodes | collapse all nodes | view schema
WBVar00143075 | Evidence | Paper_evidence | WBPaper00041308 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e268 | |||||||
Other_name (6) | |||||||||
HGVSg | CHROMOSOME_V:g.9967695C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C27H6 | |||||
Flanking_sequences | GATTTATTTATTCCGAGAAGAACGTCATTG | GGAGTAGGATCAATTCATTCCAAAAAACTT | |||||||
Mapping_target | C27H6 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00041308 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004139 | ||||||||
WBStrain00004387 | |||||||||
WBStrain00033407 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006777 | |||||||
Transcript | C27H6.1b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C27H6.1b.1:c.3561G>A | ||||||||
HGVSp | CE45373:p.Trp1187Ter | ||||||||
cDNA_position | 3561 | ||||||||
CDS_position | 3561 | ||||||||
Protein_position | 1187 | ||||||||
Exon_number | 8/11 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
C27H6.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C27H6.1a.1:c.4407G>A | ||||||||
HGVSp | CE45344:p.Trp1469Ter | ||||||||
cDNA_position | 4419 | ||||||||
CDS_position | 4407 | ||||||||
Protein_position | 1469 | ||||||||
Exon_number | 11/14 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
C27H6.1c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C27H6.1c.1:c.3288G>A | ||||||||
HGVSp | CE45298:p.Trp1096Ter | ||||||||
cDNA_position | 3288 | ||||||||
CDS_position | 3288 | ||||||||
Protein_position | 1096 | ||||||||
Exon_number | 6/8 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000518832 | ||||||||
Genetics | Interpolated_map_position | V | 2.22222 | ||||||
Mapping_data | In_2_point (3) | ||||||||
In_multi_point (15) | |||||||||
In_pos_neg_data | 307 | ||||||||
857 | |||||||||
865 | |||||||||
1739 | |||||||||
1763 | |||||||||
2170 | |||||||||
3074 | |||||||||
3113 | |||||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weak kinker; e268/Df similar | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000017 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ric; e268/Df similar | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slightly small; e268/Df similar | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000507 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | elevated acetycholine levels; e268/Df similar | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000604 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | RVG organization disrupted; e268/Df similar | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005403 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001333 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | VD1, VD2, DD1 cell bodies mispositioned, usually anteriorly; e268/Df similar | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term (3) | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on expression analysis of SNB-1::VENUS. | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Reference | WBPaper00041308 | ||||||||
WBPaper00028886 | |||||||||
WBPaper00000031 | |||||||||
WBPaper00002007 | |||||||||
Method | Substitution_allele |