WormBase Tree Display for Variation: WBVar00143075
expand all nodes | collapse all nodes | view schema
WBVar00143075 | Evidence | Paper_evidence | WBPaper00041308 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e268 | |||||
Other_name | CE45298:p.Trp1096Ter | ||||||
C27H6.1b.1:c.3561G>A | |||||||
CE45344:p.Trp1469Ter | |||||||
C27H6.1a.1:c.4407G>A | |||||||
C27H6.1c.1:c.3288G>A | |||||||
CE45373:p.Trp1187Ter | |||||||
HGVSg | CHROMOSOME_V:g.9967695C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C27H6 | |||
Flanking_sequences | GATTTATTTATTCCGAGAAGAACGTCATTG | GGAGTAGGATCAATTCATTCCAAAAAACTT | |||||
Mapping_target | C27H6 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00041308 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004139 | ||||||
WBStrain00004387 | |||||||
WBStrain00033407 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects (3) | |||||||
Genetics | Interpolated_map_position | V | 2.22222 | ||||
Mapping_data | In_2_point (3) | ||||||
In_multi_point (15) | |||||||
In_pos_neg_data | 307 | ||||||
857 | |||||||
865 | |||||||
1739 | |||||||
1763 | |||||||
2170 | |||||||
3074 | |||||||
3113 | |||||||
Description | Phenotype (7) | ||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | ||||
Curator_confirmed | WBPerson48 | ||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on expression analysis of SNB-1::VENUS. | Paper_evidence | WBPaper00028886 | ||||
Curator_confirmed | WBPerson48 | ||||||
Reference | WBPaper00041308 | ||||||
WBPaper00028886 | |||||||
WBPaper00000031 | |||||||
WBPaper00002007 | |||||||
Method | Substitution_allele |