WormBase Tree Display for Variation: WBVar00143023
expand all nodes | collapse all nodes | view schema
WBVar00143023 | Evidence | Person_evidence | WBPerson499 | ||
---|---|---|---|---|---|
Name | Public_name | e189 | |||
Other_name (6) | |||||
HGVSg | CHROMOSOME_III:g.8906966G>A | ||||
Sequence_details | SMap | S_parent | Sequence | ZK637 | |
Flanking_sequences | taaaatctccttcactaacaca | gccgggactggagaaatgttgcca | |||
Mapping_target | ZK637 | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain (303) | |||||
Laboratory (2) | |||||
Status | Live | ||||
Affects | Gene | WBGene00006768 | |||
Transcript | ZK637.8c.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | ZK637.8c.1:c.460-345G>A | ||||
Intron_number | 4/11 | ||||
ZK637.8f.1 | VEP_consequence | splice_acceptor_variant | |||
VEP_impact | HIGH | ||||
HGVSc | ZK637.8f.1:c.460-1G>A | ||||
Intron_number | 4/11 | ||||
ZK637.8e.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK637.8e.1:c.460-345G>A | ||||
Intron_number | 4/11 | ||||
ZK637.8d.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK637.8d.1:c.614+288G>A | ||||
Intron_number | 5/11 | ||||
ZK637.8b.1 | VEP_consequence | splice_acceptor_variant | |||
VEP_impact | HIGH | ||||
HGVSc | ZK637.8b.1:c.460-1G>A | ||||
Intron_number | 4/11 | ||||
ZK637.8a.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK637.8a.1:c.614+288G>A | ||||
Intron_number | 5/11 | ||||
Interactor | WBInteraction000524785 | ||||
Isolation | Mutagen | EMS | |||
Genetics | Interpolated_map_position | III | -0.00184685 | ||
Mapping_data | In_2_point (31) | ||||
In_multi_point (171) | |||||
In_pos_neg_data | 806 | ||||
3726 | |||||
Description (2) | |||||
Reference (32) | |||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Method | Substitution_allele |