WormBase Tree Display for Variation: WBVar00143020
expand all nodes | collapse all nodes | view schema
WBVar00143020 | Evidence | Paper_evidence | WBPaper00001835 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | T01B7 | |||||
Flanking_sequences | ggagcaggaaccgcttccaaccgtgtgagac | tcaacaatatggaggatatggagccactgg | |||||||
Mapping_target | T01B7 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001835 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (18) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Linked_to | WBVar00143021 | ||||||||
Affects | Gene | WBGene00004397 | |||||||
Transcript | T01B7.7.1 (12) | ||||||||
Interactor (19) | |||||||||
Genetics | Interpolated_map_position | II | 0.87118 | ||||||
Mapping_data | In_2_point | 217 | |||||||
2631 | |||||||||
5725 | |||||||||
6167 | |||||||||
6168 | |||||||||
In_multi_point (12) | |||||||||
In_pos_neg_data (20) | |||||||||
Description | Phenotype | WBPhenotype:0000502 | Paper_evidence | WBPaper00000465 | |||||
WBPaper00000906 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark (2) | |||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
WBPaper00000906 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000032 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16C, 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00033444 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033444 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001516 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Alae make 1 whole turn along the length of the animal. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000583 | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16C, 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001515 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (13) | |||||||||
Method | Substitution_allele |