WormBase Tree Display for Variation: WBVar00143011
expand all nodes | collapse all nodes | view schema
WBVar00143011 | Evidence | Paper_evidence | WBPaper00030788 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | C04F5 | |||
Flanking_sequences | gcgtgcaaagcgccttgatgaattgagatg | caattgaacaaagtgatctacgaggaaaaa | |||||
Mapping_target | C04F5 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00030788 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (4) | |||||||
Affects | Gene | WBGene00006782 | |||||
Transcript | C04F5.3.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | C04F5.3.1:c.372G>A | ||||||
HGVSp | CE27791:p.Trp124Ter | ||||||
cDNA_position | 494 | ||||||
CDS_position | 372 | ||||||
Protein_position | 124 | ||||||
Exon_number | 5/9 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
Genetics | Interpolated_map_position | V | -2.51992 | ||||
Mapping_data | In_2_point (27) | ||||||
In_multi_point (24) | |||||||
In_pos_neg_data | 845 | ||||||
2134 | |||||||
3076 | |||||||
3259 | |||||||
Description | Phenotype | WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | slightly small | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000563 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | shrinker contracts both dorsally and ventrally when prodded | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||
WBPaper00001474 | |||||||
Curator_confirmed | WBPerson48 | ||||||
WBPerson712 | |||||||
Remark | Unc | Paper_evidence | WBPaper00001474 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | slow, good forward movement | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001005 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | poor backing | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00029020 | ||||||
WBPaper00001474 | |||||||
WBPaper00000031 | |||||||
WBPaper00014148 | |||||||
WBPaper00022021 | |||||||
WBPaper00025822 | |||||||
Remark | Site of e177 lesion was estimated from figure 1; actual coordinates are not provided in the paper. | Paper_evidence | WBPaper00030788 | ||||
Method | Substitution_allele |