WormBase Tree Display for Variation: WBVar00142948
expand all nodes | collapse all nodes | view schema
WBVar00142948 | Evidence | Paper_evidence | WBPaper00001431 | ||
---|---|---|---|---|---|
Person_evidence | WBPerson267 | ||||
Name | Public_name | e73 | |||
Other_name (5) | |||||
HGVSg | CHROMOSOME_I:g.7379262C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F07A5 | |
Flanking_sequences | gagatcatgctccagaagatttctcaactc | agaaggccaagtctcgtcttcaatctgagg | |||
Mapping_target | F07A5 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain (35) | |||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00006754 | |||
Transcript | F07A5.7a.1 (12) | ||||
F07A5.7a.2 (12) | |||||
F07A5.7b.1 (12) | |||||
Interactor | WBInteraction000518394 | ||||
WBInteraction000518614 | |||||
WBInteraction000518905 | |||||
Isolation (2) | |||||
Genetics | Interpolated_map_position | I | 2.05567 | ||
Mapping_data | In_2_point | 13 | |||
238 | |||||
516 | |||||
1017 | |||||
In_multi_point (14) | |||||
In_pos_neg_data | 515 | ||||
2518 | |||||
4992 | |||||
4999 | |||||
5003 | |||||
5345 | |||||
Description | Phenotype (10) | ||||
Reference (31) | |||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006754 Missense 342 E to K | ||||
Method | Substitution_allele |