WormBase Tree Display for Variation: WBVar00142894

WBVar00142894 Evidence: Paper_evidence: WBPaper00006177
  Name: Public_name: dx77
  Sequence_details: SMap: S_parent: Sequence: T12A7
    Flanking_sequences: gctggaggtggagaatctactcaaattccg gtaaatcttaagcttttcagcaactttaaa
    Mapping_target: T12A7
    Type_of_mutation: Insertion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00007126
    Laboratory: EJ
    Status: Live
  Affects: Gene: WBGene00001577
    Transcript: T12A7.1.2
      T12A7.1.1
    Interactor: WBInteraction000051952
      WBInteraction000051955
  Genetics: Interpolated_map_position: IV 5.27212
  Reference: WBPaper00006177
  Remark: dx77 is predicted to result in the insertion of the following string of amino acids: INLKLFSNFKIYNFQ Paper_evidence: WBPaper00006177
  Method: Insertion_allele