WormBase Tree Display for Variation: WBVar00095135
expand all nodes | collapse all nodes | view schema
WBVar00095135 | Name | Public_name | p1152 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | ZC416.8b.1:c.1751C>T | ||||||||
CE17308:p.Pro584Leu | |||||||||
HGVSg | CHROMOSOME_IV:g.3614187G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC416 | |||||
Flanking_sequences | GTGCAGTGGTCCGCGATGGCTATGGATGCC | GTACAATATTCAACCGGATCGAGTGATTTT | |||||||
Mapping_target | ZC416 | ||||||||
Type_of_mutation | Substitution | C | T | Person_evidence | WBPerson13860 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027069 | ||||||||
WBStrain00030801 | |||||||||
Laboratory | PR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000481 | |||||||
Transcript | ZC416.8b.1 (12) | ||||||||
Interactor | WBInteraction000518557 | ||||||||
Genetics | Interpolated_map_position | IV | -3.11911 | ||||||
Mapping_data | In_2_point | 523 | |||||||
In_multi_point | 52 | ||||||||
275 | |||||||||
455 | |||||||||
458 | |||||||||
462 | |||||||||
466 | |||||||||
596 | |||||||||
923 | |||||||||
924 | |||||||||
Description | Phenotype | WBPhenotype:0000017 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ric (resistant to aldicarb, trichlorfon) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00002865 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000019 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slow pumping | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000031 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slow-growing | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00040570 | |||||||
Curator_confirmed | WBPerson8126 | ||||||||
Remark | Fig. 3 reduction in lifespan upon reserpine treatment, opposite to what is seen in wild type animals | Paper_evidence | WBPaper00040570 | ||||||
Curator_confirmed | WBPerson8126 | ||||||||
Affected_by | Molecule | WBMol:00002955 | Paper_evidence | WBPaper00040570 | |||||
Curator_confirmed | WBPerson8126 | ||||||||
WBPhenotype:0000124 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 99% reduced choline acetyltransferase | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000246 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00040041 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit AVM ventral axon guidance defects. DD and VD neurons migrate normally in these mutants and are unaffected by exogenous acetylcholine. | Paper_evidence | WBPaper00040041 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004765 | Paper_evidence | WBPaper00040041 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00040041 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000565 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | uncoordinated (coiler) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000631 | Paper_evidence | WBPaper00036766 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | cha-1 reduction-of-function allele did not significantly alter fluoxetine sensitivity. | Paper_evidence | WBPaper00036766 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00036766 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005058 | Paper_evidence | WBPaper00036766 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00016510 | ||||||||
WBPaper00040041 | |||||||||
WBPaper00040570 | |||||||||
WBPaper00016519 | |||||||||
WBPaper00029012 | |||||||||
WBPaper00022015 | |||||||||
WBPaper00016184 | |||||||||
WBPaper00017502 | |||||||||
WBPaper00036766 | |||||||||
Remark | Sequenced the above strain and found the above mutation, corresponding to the uncharacterised p1152 allele. | Person_evidence | WBPerson13860 | ||||||
Method | Substitution_allele |