WormBase Tree Display for Variation: WBVar00095124
expand all nodes | collapse all nodes | view schema
WBVar00095124 | Evidence | Paper_evidence | WBPaper00004879 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | p767 | |||||||
Other_name | Y113G7A.6a.1:c.129+1G>A | ||||||||
Y113G7A.6c.1:c.18+1G>A | |||||||||
Y113G7A.6b.1:c.129+1G>A | |||||||||
Y113G7A.6d.1:c.93+1G>A | |||||||||
HGVSg | CHROMOSOME_V:g.20059673C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y113G7A | |||||
Flanking_sequences | ggatcaactacaatgaacagcggaaatttt | tgggttttttaaaattaaatttttttcagt | |||||||
Mapping_target | Y113G7A | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030792 | ||||||||
Laboratory | PR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006652 | |||||||
Transcript (4) | |||||||||
Interactor (13) | |||||||||
Genetics (2) | |||||||||
Description | Phenotype | WBPhenotype:0000997 | Paper_evidence | WBPaper00035614 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | ttx-1 mutants showed a strong tendency to migrate toward the cold area of the temperature gradient, regardless of the conditioning temperature | Paper_evidence | WBPaper00035614 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
mutant animals strongly cryophilic | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001273 | Paper_evidence | WBPaper00031874 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutations affecting the AFD or AIY neurons reduced heat shock-dependent accumulation of hsp70 (C12C8.1) mRNA at 30C and 34C | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to a transient increase in temperature (30C or 34C for 15 min), and their heat shock response was measured as the total amount of hsp70 (C12C8.1) mRNA, 2 hours after heat shock | Paper_evidence | WBPaper00031874 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002088 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | hypersensitive to dauer pheromone | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
neuron AFD lacks "fingers" (microvilli) | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000238 | Paper_evidence | WBPaper00035327 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ttx-1(AFD) did not show any significant phenotype for roaming behavior | Paper_evidence | WBPaper00035327 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031936 | ||||||||
WBPaper00031874 | |||||||||
WBPaper00035327 | |||||||||
WBPaper00015583 | |||||||||
WBPaper00014724 | |||||||||
WBPaper00011136 | |||||||||
WBPaper00020867 | |||||||||
WBPaper00035614 | |||||||||
WBPaper00061932 | |||||||||
Method | Substitution_allele |