WormBase Tree Display for Variation: WBVar00095121
expand all nodes | collapse all nodes | view schema
WBVar00095121 | Evidence | Paper_evidence | WBPaper00002584 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | p694 | |||||||
HGVSg | CHROMOSOME_I:g.9020681_9021069delinsAAAAATATAAAAAAAAAAAATATAAAAAAAAAATAT | ||||||||
Sequence_details | SMap | S_parent | Sequence | F36F2 | |||||
Flanking_sequences | tagcaagaaagagaaagagaagaagaagaa | aataagaaaaaaacactttatctgttcaga | |||||||
Mapping_target | F36F2 | ||||||||
Type_of_mutation (2) | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000313 | ||||||||
WBStrain00000314 | |||||||||
WBStrain00000315 | |||||||||
WBStrain00000316 | |||||||||
WBStrain00000317 | |||||||||
WBStrain00030790 | |||||||||
Laboratory | PR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006525 | |||||||
Transcript | F36F2.5.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
Intron_number | 1/14 | ||||||||
Exon_number | 1/15 | ||||||||
Genetics | Interpolated_map_position | I | 3.39841 | ||||||
Description | Phenotype | WBPhenotype:0000254 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were completely defective in NaCl chemotaxis but not to NaAc in water soluble assays compared to wild-type. | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the water soluble chemotaxis assay, radial gradients of NaCl were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00031959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were completely defective in NaCl chemotaxis in water soluble assays. | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the water soluble chemotaxis assay, radial gradients of NaCl were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001435 | Paper_evidence | WBPaper00031959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed a reduction in chemotaxis to ammonium chloride compared to wild-type, but were not significantly defective in comparison to positive control che-1(p679) animals. | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002092 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the soluble assay, radial gradients of NH4Cl were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001442 | Paper_evidence | WBPaper00031959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed a reduction in chemotaxis to sodium acetate compared to wild-type animals but, animals still showed residual positive chemotaxis similar to che-1(p679). | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004924 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the soluble assay, radial gradients of NaAc were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001737 | Paper_evidence | WBPaper00031959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were not able to locate the gradient peak of sodium in a high uniform background of ammonium chloride; however animals were able to discriminate chloride in a high uniform background of sodium acetate. | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the discrimination assay, a NaAc gradient was formed on top of a high uniform background of NH4Cl or a NH4Cl gradient was formed on top of a high uniform background of NaAc. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Acute CO2 avoidance is eliminated | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002378 | Paper_evidence | WBPaper00054670 | |||||||
Curator_confirmed | WBPerson2706 | ||||||||
Remark | animals defective in their ability to avoid OP50 lawns contaminated with Microbacterium nematophilum | Paper_evidence | WBPaper00054670 | ||||||
Curator_confirmed | WBPerson2706 | ||||||||
Phenotype_not_observed | WBPhenotype:0001736 | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed no defect in acetate chemotaxis in water soluble assays when compared to che-1(p679) positive control animals. | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005057 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the water soluble chemotaxis assay, radial gradients of NaAc were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001738 | Paper_evidence | WBPaper00031959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed no defect in ammonium chemotaxis in water soluble assays when compared to che-1(p679) positive control animals. | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002091 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the water soluble chemotaxis assay, radial gradients of NH4Cl were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00031936 | ||||||||
WBPaper00031959 | |||||||||
WBPaper00014724 | |||||||||
WBPaper00054670 | |||||||||
Remark | p649 is a deletion allele that completely removes the first exon and aprox. 1.8 kb of upstream sequences. Flanks are estimated from the description; exact breakpoints are not detailed in the paper. | Paper_evidence | WBPaper00002584 | ||||||
Original Flanking_sequences:ctgggaattcaaaaatcagcatcagctgtc gtacataatcttcagaatctgaaaaataaa | |||||||||
This allele has been described in Coburn and Bargmann, Neuron 695-706 (1996). They report a 1.8 kb deletion, removing exon 1 and upstream sequences. We found a 389 bp deletion, still removing exon 1 of tax-2. And insertion of AAAAATATAAAAAAAAAAAATATAAAAAAAAAATAT | Person_evidence | WBPerson291 | |||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006525 Regulatory_feature | Paper_evidence | WBPaper00002584 | |||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006525 Genomic_neighbourhood | |||||||||
Method | Deletion_and_insertion_allele |