WormBase Tree Display for Variation: WBVar00095121
expand all nodes | collapse all nodes | view schema
| WBVar00095121 | Evidence | Paper_evidence | WBPaper00002584 | ||
|---|---|---|---|---|---|
| Name | Public_name | p694 | |||
| HGVSg | CHROMOSOME_I:g.9020681_9021069delinsAAAAATATAAAAAAAAAAAATATAAAAAAAAAATAT | ||||
| Sequence_details | SMap | S_parent | Sequence | F36F2 | |
| Flanking_sequences | tagcaagaaagagaaagagaagaagaagaa | aataagaaaaaaacactttatctgttcaga | |||
| Mapping_target | F36F2 | ||||
| Type_of_mutation | Insertion | AAAAATATAAAAAAAAAAAATATAAAAAAAAAATAT | |||
| Deletion | gcacgcaagggaggtcatatcaactagtatttccatttgagagaaggagatggatagagaaggcttttagaaggttttaatatttatcactggaaatttaagccttcctatcatttctttgcgtctccttgtatatatcttcactatattgtttcctgttttcgtaactattttgaatcgtttttttcaaacccaagtttccatgttcaattggatttttacagtttcgtttcagaaatgtcagaaaaaccggagttttccgatatgtatcaagttccaaaacgagcaaaaacaaacttggctcgcgaaatacggaaaagagagttcagttatgtggatagacaggtacataatcttcagaatctgaaaaataaaaaagtattttaaaa | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00000313 | ||||
| WBStrain00000314 | |||||
| WBStrain00000315 | |||||
| WBStrain00000316 | |||||
| WBStrain00000317 | |||||
| WBStrain00030790 | |||||
| Laboratory | PR | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00006525 | |||
| Transcript | F36F2.5.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||
| VEP_impact | HIGH | ||||
| Intron_number | 1/14 | ||||
| Exon_number | 1/15 | ||||
| Genetics | Interpolated_map_position | I | 3.39841 | ||
| Description (2) | |||||
| Reference | WBPaper00031936 | ||||
| WBPaper00031959 | |||||
| WBPaper00014724 | |||||
| WBPaper00054670 | |||||
| Remark | p649 is a deletion allele that completely removes the first exon and aprox. 1.8 kb of upstream sequences. Flanks are estimated from the description; exact breakpoints are not detailed in the paper. | Paper_evidence | WBPaper00002584 | ||
| Original Flanking_sequences:ctgggaattcaaaaatcagcatcagctgtc gtacataatcttcagaatctgaaaaataaa | |||||
| This allele has been described in Coburn and Bargmann, Neuron 695-706 (1996). They report a 1.8 kb deletion, removing exon 1 and upstream sequences. We found a 389 bp deletion, still removing exon 1 of tax-2. And insertion of AAAAATATAAAAAAAAAAAATATAAAAAAAAAATAT | Person_evidence | WBPerson291 | |||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006525 Regulatory_feature | Paper_evidence | WBPaper00002584 | |||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006525 Genomic_neighbourhood | |||||
| Method | Deletion_and_insertion_allele |
