WormBase Tree Display for Variation: WBVar00095119
expand all nodes | collapse all nodes | view schema
WBVar00095119 | Evidence | Paper_evidence | WBPaper00002584 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | p691 | ||||||
Other_name | F36F2.5.1:c.1282C>T | |||||||
CE17780:p.Pro428Ser | ||||||||
HGVSg | CHROMOSOME_I:g.9023823C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C31H5 | ||||
Flanking_sequences | gtggccacatctactggaaataacccagca | caactaatgttatcgagtgagtgactagtt | ||||||
Mapping_target | C31H5 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002584 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00030788 | |||||||
Laboratory | PR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006525 | ||||||
Transcript | F36F2.5.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | F36F2.5.1:c.1282C>T | |||||||
HGVSp | CE17780:p.Pro428Ser | |||||||
cDNA_position | 1282 | |||||||
CDS_position | 1282 | |||||||
Protein_position | 428 | |||||||
Exon_number | 8/15 | |||||||
Codon_change | Cca/Tca | |||||||
Amino_acid_change | P/S | |||||||
Interactor | WBInteraction000501490 | |||||||
WBInteraction000501959 | ||||||||
WBInteraction000501963 | ||||||||
Genetics | Interpolated_map_position | I | 3.40676 | |||||
Description | Phenotype (14) | |||||||
Phenotype_not_observed | WBPhenotype:0001285 | Paper_evidence | WBPaper00045598 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants show a significant reduction in pumping following exposure to 10% CO2, similar to the reduction observed in wild-type (N2) animals | Paper_evidence | WBPaper00045598 | |||||
Curator_confirmed | WBPerson712 | |||||||
When exposed to 10% CO2, mutants stopped pumping, similar to wild-type animals. | Paper_evidence | WBPaper00045598 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003023 | Paper_evidence | WBPaper00045598 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001448 | Paper_evidence | WBPaper00002930 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Benzaldehyde avoidance of tax-2 mutants is indistinguishable from that of wild-type | Paper_evidence | WBPaper00002930 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | 2-3 ul of benzaldehyde | Paper_evidence | WBPaper00002930 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001736 | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed no defect in acetate chemotaxis in water soluble assays when compared to che-1(p679) positive control animals (data not shown). | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00005057 | Paper_evidence | WBPaper00031959 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | For the water soluble chemotaxis assay, radial gradients of NaAc were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001897 | Paper_evidence | WBPaper00032087 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Loss-of-function mutations in the TAX-2 CNG channels do not affect the overall locomotion response to short wavelength light | Paper_evidence | WBPaper00032087 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032087 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (19) | ||||||||
Method | Substitution_allele |