WormBase Tree Display for Variation: WBVar00095117

WBVar00095117 Evidence: Paper_evidence: WBPaper00005810
  Name: Public_name: p679
    Other_name: CE34280:p.Arg154Ter
      CE40380:p.Arg213Ter
      C55B7.12b.1:c.637C>T
      C55B7.12a.1:c.460C>T
    HGVSg: CHROMOSOME_I:g.6518330G>A
  Sequence_details: SMap: S_parent: Sequence: C55B7
    Flanking_sequences: ttttctcaaagttcttctcttgttactcat gaaggtattagaggaagggtccattactat
    Mapping_target: C55B7
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00030786
    Laboratory: PR
    Status: Live
  Affects: Gene: WBGene00000483
    Transcript: C55B7.12a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C55B7.12a.1:c.460C>T
        HGVSp: CE34280:p.Arg154Ter
        cDNA_position: 460
        CDS_position: 460
        Protein_position: 154
        Exon_number: 4/5
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
      C55B7.12b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C55B7.12b.1:c.637C>T
        HGVSp: CE40380:p.Arg213Ter
        cDNA_position: 676
        CDS_position: 637
        Protein_position: 213
        Exon_number: 6/8
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
    Interactor: WBInteraction000558068
      WBInteraction000558069
      WBInteraction000558070
      WBInteraction000558071
      WBInteraction000558072
      WBInteraction000558073
      WBInteraction000558074
      WBInteraction000558075
  Genetics: Interpolated_map_position: I 1.20504
  Description: Phenotype: WBPhenotype:0000131 Paper_evidence: WBPaper00032073
        Curator_confirmed: WBPerson712
        Remark: 7% dauer induction (N=176). Paper_evidence: WBPaper00032073
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were exposed to 32 ul exogenous dauer pheromone. Paper_evidence: WBPaper00032073
              Curator_confirmed: WBPerson712
          Temperature: 25 Paper_evidence: WBPaper00032073
              Curator_confirmed: WBPerson712
      WBPhenotype:0000254 Paper_evidence: WBPaper00031959
        Curator_confirmed: WBPerson712
        Remark: Animals were completely defective in NaCl chemotaxis but not to NaAc in water soluble assays compared to wild-type. Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00003571 Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: For the water soluble chemotaxis assay, radial gradients of NaCl were established by diffusion in the agar. Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
      WBPhenotype:0001084 Paper_evidence: WBPaper00031959
        Curator_confirmed: WBPerson712
        Remark: Animals were completely defective in NaCl chemotaxis in water soluble assays. Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00003571 Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: For the water soluble chemotaxis assay, radial gradients of NaCl were established by diffusion in the agar. Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
      WBPhenotype:0001435 Paper_evidence: WBPaper00031959
        Curator_confirmed: WBPerson712
        Remark: Animals showed a reduction in chemotaxis to ammonium chloride compared to wild-type. Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Penetrance: Incomplete: Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00002092 Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: For the soluble assay, radial gradients of NH4Cl were established by diffusion in the agar. Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
      WBPhenotype:0001442 Paper_evidence: WBPaper00031959
        Curator_confirmed: WBPerson712
        Remark: Animals showed a reduction in chemotaxis to sodium acetate compared to wild-type animals. Animals still showed residual positive chemotaxis. Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Penetrance: Incomplete: Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00004924 Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: For the soluble assay, radial gradients of NaAc were established by diffusion in the agar. Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
      WBPhenotype:0001737 Paper_evidence: WBPaper00031959
        Curator_confirmed: WBPerson712
        Remark: Animals were not able to locate the gradient peak of sodium in a high uniform background of ammonium chloride; however animals were able to discriminate chloride in a high uniform background of sodium acetate. Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: For the discrimination assay, a NaAc gradient was formed on top of a high uniform background of NH4Cl or a NH4Cl gradient was formed on top of a high uniform background of NaAc. Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
      WBPhenotype:0002171 Paper_evidence: WBPaper00042397
        Curator_confirmed: WBPerson1928
        Remark: Animals are defective in chemotaxis towards attractive alkaline pH Paper_evidence: WBPaper00042397
            Curator_confirmed: WBPerson1928
    Phenotype_not_observed: WBPhenotype:0000238 Paper_evidence: WBPaper00035327
        Curator_confirmed: WBPerson2021
        Remark: che-1(ASE) did not show any significant phenotype for roaming behavior Paper_evidence: WBPaper00035327
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001438 Paper_evidence: WBPaper00001786
          WBPaper00031959
        Curator_confirmed: WBPerson2021
          WBPerson712
        Remark: Animals are not defective in chemotaxis to ammonium acetate in the odorant assay, compared to wild-type. Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00002790 Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00001786
                Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: For the odorant assay, a droplet of NH4Ac (10 mL, 7.5 M) was suspended from the lid of the plate. Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
      WBPhenotype:0001441 Paper_evidence: WBPaper00031959
        Curator_confirmed: WBPerson712
        Remark: Animals did not show a reduction in chemotaxis to ammonium acetate in either the soluble or odorant assay, compared to wild-type animals. Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00002790 Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: For the water soluble chemotaxis assay, radial gradients of NH4Ac were established by diffusion in the agar. Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
      WBPhenotype:0001484 Paper_evidence: WBPaper00031959
        Curator_confirmed: WBPerson712
        Remark: Animals did not show a reduction in chemotaxis to ammonium acetate compared to wild-type animals. Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00002790 Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were tested in both soluble and odorant chemotaxis assays. For the soluble assay, radial gradients of NH4Ac were established by diffusion in the agar. For the odorant assay, a droplet of NH4Ac (10 mL, 7.5 M) was suspended from the lid of the plate. Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
      WBPhenotype:0001736 Paper_evidence: WBPaper00031959
        Curator_confirmed: WBPerson712
        Remark: Animals showed residual chemotaxis to acetate in water soluble assays when compared to wild-type. Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00005057 Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: For the water soluble chemotaxis assay, radial gradients of NaAc were established by diffusion in the agar. Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
      WBPhenotype:0001738 Paper_evidence: WBPaper00031959
        Curator_confirmed: WBPerson712
        Remark: Animals showed residual chemotaxis to ammonium in water soluble assays when compared to wild-type. Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00002091 Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: For the water soluble chemotaxis assay, radial gradients of NH4Cl were established by diffusion in the agar. Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
      WBPhenotype:0001765 Paper_evidence: WBPaper00031936
        Curator_confirmed: WBPerson2021
        Remark: Mutants respond normally to CO2 Paper_evidence: WBPaper00031936
            Curator_confirmed: WBPerson2021
        EQ_annotations: Life_stage: WBls:0000057 PATO:0000460 Paper_evidence: WBPaper00031936
                Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: 10% CO2 Paper_evidence: WBPaper00031936
              Curator_confirmed: WBPerson2021
  Reference: WBPaper00032073
    WBPaper00031936
    WBPaper00011915
    WBPaper00001786
    WBPaper00031959
    WBPaper00035327
    WBPaper00042397
  Method: Substitution_allele