WormBase Tree Display for Variation: WBVar00095036
expand all nodes | collapse all nodes | view schema
WBVar00095036 | Evidence | Paper_evidence | WBPaper00005098 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | oy38 | |||||||
Other_name | F58H12.1.1:c.1314-275_1565del | ||||||||
HGVSg | CHROMOSOME_X:g.2846623_2847149del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F58H12 | |||||
Flanking_sequences | tgttgtgtcaaatcgaagttagttggcaga | aaacaaactattttatcaaagttaatttg | |||||||
Mapping_target | F58H12 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031130 | ||||||||
WBStrain00047961 | |||||||||
WBStrain00047962 | |||||||||
Laboratory | PY | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002210 | |||||||
Transcript | F58H12.1.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F58H12.1.1:c.1314-275_1565del | ||||||||
cDNA_position | ?-1616 | ||||||||
CDS_position | ?-1565 | ||||||||
Protein_position | ?-522 | ||||||||
Intron_number | 12/17 | ||||||||
Exon_number | 13/18 | ||||||||
Interactor | WBInteraction000569803 | ||||||||
Genetics | Interpolated_map_position | X | -12.7094 | ||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00060059 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "As previously reported (Lanjuin and Sengupta, 2002), kin-29(oy38) mutants are long-lived." Figure 1A, 1B | Paper_evidence | WBPaper00060059 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Strain | WBStrain00047961 | Paper_evidence | WBPaper00060059 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00060059 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00025090 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show a reduction in brood size | Paper_evidence | WBPaper00025090 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00025090 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | kin-29 mutant animals are small. The Sma body size of kin-29 is due to a delay in development in later larval stages | Paper_evidence | WBPaper00025090 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00051005 | |||||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | "a null mutation of kin-29, the C. elegans orthologue of Sik3, reduced the fraction of quiescence during L4-adult lethargus, a sleep-like state in C. elegans (Fig. 3e)"; In figure 3e legend, "kin-29(oy38); PH20::kin-29 worms (n=9), in which wild type kin-29 was expressed in neuronal cells, restored normal quiescence during lethargus." | Paper_evidence | WBPaper00051005 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00051005 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
EQ_annotations | Life_stage | WBls:0000039 | PATO:0000460 | Paper_evidence | WBPaper00051005 | ||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_assay | Strain | WBStrain00031130 | Paper_evidence | WBPaper00051005 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00051005 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
WBPhenotype:0002432 | Paper_evidence | WBPaper00059622 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | KIN-29 AID transgenic animals cultivated on auxin throughout development mimicked the kin-29(oy38) null mutant SIS | Paper_evidence | WBPaper00059622 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0004030 | Paper_evidence | WBPaper00061691 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | "...kin-2 mutant males as well those mutant for kin-29, F47F2.1 or pde-4, which all affect cAMP-dependent signaling, were not obviously defective in their response to hermaphrodites." | Paper_evidence | WBPaper00061691 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00025090 | ||||||||
WBPaper00051005 | |||||||||
WBPaper00059622 | |||||||||
WBPaper00060059 | |||||||||
WBPaper00061691 | |||||||||
WBPaper00064927 | |||||||||
Method | Deletion_allele |