WormBase Tree Display for Variation: WBVar00094687
expand all nodes | collapse all nodes | view schema
WBVar00094687 | Evidence | Paper_evidence | WBPaper00005096 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | or180 | ||||||
Other_name | CE26888:p.Ser502Phe | |||||||
F10C5.1.1:c.1505C>T | ||||||||
HGVSg | CHROMOSOME_III:g.481323C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F10C5 | ||||
Flanking_sequences | aggaagctcaaaaatgcaaaccccatgatt | tcggcttctcgtggctctcggtgatatata | ||||||
Mapping_target | F10C5 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006407 | |||||||
Laboratory | EU | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003134 | ||||||
Transcript | F10C5.1.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | F10C5.1.1:c.1505C>T | |||||||
HGVSp | CE26888:p.Ser502Phe | |||||||
cDNA_position | 1514 | |||||||
CDS_position | 1505 | |||||||
Protein_position | 502 | |||||||
Exon_number | 8/10 | |||||||
Codon_change | tCt/tTt | |||||||
Amino_acid_change | S/F | |||||||
Interactor | WBInteraction000052178 | |||||||
WBInteraction000500085 | ||||||||
WBInteraction000500086 | ||||||||
WBInteraction000500089 | ||||||||
WBInteraction000500092 | ||||||||
WBInteraction000518318 | ||||||||
Genetics | Interpolated_map_position | III | -26.8385 | |||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00032281 | ||||
WBPaper00037671 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 10/342 eggs hatched. | Paper_evidence | WBPaper00032281 | |||||
Curator_confirmed | WBPerson712 | |||||||
Suppressed by such-1(av9). | Paper_evidence | WBPaper00037671 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 24 | Paper_evidence | WBPaper00032281 | ||||
WBPaper00037671 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Three L4 hermaphrodites fed with HT115 bacteria expressing pUC19 as a control plasmid, were shifted to 24 C for 36 h, and then the total number of eggs laid and hatching were counted. | Paper_evidence | WBPaper00032281 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000313 | Paper_evidence | WBPaper00032281 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Embryos arrested at metaphase of meiosis I; animals laid one-cell embryos (n=30). | Paper_evidence | WBPaper00032281 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | High | Paper_evidence | WBPaper00032281 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 24 | Paper_evidence | WBPaper00032281 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Thirty L4 hermaphrodites fed with HT115 bacteria with control vector pUC10 were shifted to 24C for 24 h, fixed with methanol and acetone, and then stained with 100 ng/ml DAPI. The numbers of worms that lay only embryos in meiotic division (one cell) and those that lay embryos that had entered mitosis (more than one cell) are shown. | Paper_evidence | WBPaper00032281 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001216 | Paper_evidence | WBPaper00004484 | ||||||
Curator_confirmed | WBPerson205 | |||||||
Reference | WBPaper00018375 | |||||||
WBPaper00037671 | ||||||||
WBPaper00004484 | ||||||||
WBPaper00032281 | ||||||||
WBPaper00025832 | ||||||||
WBPaper00010392 | ||||||||
Method | Substitution_allele |