WormBase Tree Display for Variation: WBVar00094680
expand all nodes | collapse all nodes | view schema
| WBVar00094680 | Evidence | Paper_evidence | WBPaper00003574 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | or131 | |||||||
| Other_name (13) | |||||||||
| HGVSg | CHROMOSOME_III:g.13722833G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | W06F12 | |||||
| Flanking_sequences | aagggcgtctgcgattccactcgtgtatgt | ctcgtgctgctatacgaaaccaaatatgcc | |||||||
| Mapping_target | W06F12 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003574 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00007293 | ||||||||
| Laboratory | EU | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003048 | |||||||
| Transcript | W06F12.1a.1 (12) | ||||||||
| W06F12.1c.1 (12) | |||||||||
| W06F12.1b.1 (12) | |||||||||
| W06F12.1e.1 (12) | |||||||||
| W06F12.1d.2 (12) | |||||||||
| W06F12.1d.1 (12) | |||||||||
| W06F12.1d.3 (12) | |||||||||
| Interactor (22) | |||||||||
| Genetics | Interpolated_map_position | III | 21.4043 | ||||||
| Description | Phenotype (12) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000961 | Paper_evidence | WBPaper00027345 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | lit-1(or131) did not affect the normal asymmetric expression of POP-1::GFP in B daughter cells | Paper_evidence | WBPaper00027345 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006985 | PATO:0000460 | Paper_evidence | WBPaper00027345 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBbt:0006986 | PATO:0000460 | Paper_evidence | WBPaper00027345 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00027345 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00032264 | ||||||||
| WBPaper00027345 | |||||||||
| WBPaper00033469 | |||||||||
| WBPaper00026118 | |||||||||
| WBPaper00005116 | |||||||||
| WBPaper00024491 | |||||||||
| WBPaper00003574 | |||||||||
| WBPaper00045459 | |||||||||
| Remark | The lesion described is an update of that presented in the Meneghini et al (1999) paper | Person_evidence | WBPerson22972 | ||||||
| Method | Substitution_allele |
