WormBase Tree Display for Variation: WBVar00094625
expand all nodes | collapse all nodes | view schema
WBVar00094625 | Evidence | Paper_evidence | WBPaper00005259 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | op147 | |||||||
Other_name | op147::Tc1 | ||||||||
Sequence_details | SMap | S_parent | Sequence | F38A3 | |||||
Flanking_sequences | tatgtggatggatatgacaaaccaagaagc | attgccacccagggaccactcccggaaaca | |||||||
Mapping_target | F38A3 | ||||||||
Type_of_mutation | Insertion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Transposon_insertion | |||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (2) | |||||||||
Laboratory | WS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004215 | |||||||
Transcript (14) | |||||||||
Interactor | WBInteraction000501253 | ||||||||
WBInteraction000501254 | |||||||||
Genetics | Interpolated_map_position | II | 3.14034 | ||||||
Description | Phenotype | WBPhenotype:0000384 | Paper_evidence | WBPaper00038275 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ptp-3(op147) mutants show a low frequency of PLM overextensiondefects. | Paper_evidence | WBPaper00038275 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00038275 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00038275 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00038275 | ||||||||
WBPaper00032446 | |||||||||
WBPaper00017737 | |||||||||
WBPaper00016760 | |||||||||
Remark | The TC1 insertion disrupts the Y codon | Paper_evidence | WBPaper00005259 | ||||||
Method | Transposon_insertion |