WormBase Tree Display for Variation: WBVar00094625
expand all nodes | collapse all nodes | view schema
| WBVar00094625 | Evidence | Paper_evidence | WBPaper00005259 | ||
|---|---|---|---|---|---|
| Name | Public_name | op147 | |||
| Other_name | op147::Tc1 | ||||
| Sequence_details | SMap | S_parent | Sequence | F38A3 | |
| Flanking_sequences | tatgtggatggatatgacaaaccaagaagc | attgccacccagggaccactcccggaaaca | |||
| Mapping_target | F38A3 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Transposon_insertion | |||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00005353 | ||||
| WBStrain00005368 | |||||
| Laboratory | WS | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00004215 | |||
| Transcript (14) | |||||
| Interactor | WBInteraction000501253 | ||||
| WBInteraction000501254 | |||||
| Genetics | Interpolated_map_position | II | 3.14034 | ||
| Description (2) | |||||
| Reference | WBPaper00038275 | ||||
| WBPaper00032446 | |||||
| WBPaper00017737 | |||||
| WBPaper00016760 | |||||
| Remark | The TC1 insertion disrupts the Y codon | Paper_evidence | WBPaper00005259 | ||
| Method | Transposon_insertion |
