WormBase Tree Display for Variation: WBVar00094621
expand all nodes | collapse all nodes | view schema
| WBVar00094621 | Evidence | Paper_evidence | WBPaper00004137 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | om96 | |||||
| Other_name | CE27140:p.His139Leu | ||||||
| F26A3.3.1:c.416A>T | |||||||
| HGVSg | CHROMOSOME_I:g.7655770T>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | F26A3 | |||
| Flanking_sequences | ctaacgtcatcccagaaagacacttcccaa | gattaatgaatgttccgccttgaatatttc | |||||
| Mapping_target | F26A3 | ||||||
| Type_of_mutation | Substitution | t | a | Curator_confirmed | WBPerson4055 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | EL | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001214 | |||||
| Transcript | F26A3.3.1 (12) | ||||||
| Genetics | Interpolated_map_position | I | 2.21486 | ||||
| Description | Phenotype (4) | ||||||
| Reference | WBPaper00004137 | ||||||
| Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
| [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
| Method | Substitution_allele |
