WormBase Tree Display for Variation: WBVar00094344
expand all nodes | collapse all nodes | view schema
WBVar00094344 | Evidence | Paper_evidence | WBPaper00040857 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok3308 | |||||
Other_name | R06C1.3a.1:c.362_741+176del | ||||||
HGVSg | CHROMOSOME_I:g.11928542_11929097del | ||||||
Sequence_details | SMap | S_parent | Sequence | R06C1 | |||
Flanking_sequences | ttggcctgctcggggagcacaagagctgtg | ctgtaggtaaagtgcttctatccagaatat | |||||
Mapping_target | R06C1 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok3308_external | ||||||
ok3308_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00037507 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00305553 | |||||
WBGene00006958 | |||||||
Transcript | R06C1.15 | ||||||
R06C1.3a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | R06C1.3a.1:c.362_741+176del | ||||||
cDNA_position | 371-? | ||||||
CDS_position | 362-? | ||||||
Protein_position | 121-? | ||||||
Intron_number | 3/6 | ||||||
Exon_number | 3/7 | ||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Mutants showed normal localization of SNB-1::VENUS in the RIA neuron. | Paper_evidence | WBPaper00040857 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00040857 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |