WormBase Tree Display for Variation: WBVar00094340
expand all nodes | collapse all nodes | view schema
WBVar00094340 | Evidence | Person_evidence | WBPerson3620 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok3297 | |||||
HGVSg | CHROMOSOME_V:g.20376112_20376769del | ||||||
Sequence_details | SMap | S_parent | Sequence | K02E2 | |||
Flanking_sequences | CTAATTTAAGTCCAAATTTTCCAGAGATTC | AATTGGAAATTTCCGGCAAATCGGCAAATG | |||||
Mapping_target | K02E2 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00033087 | ||||||
WBStrain00048120 | |||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
WBPerson3620 | |||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00002118 | |||||
Transcript | K02E2.4.1 | VEP_consequence | coding_sequence_variant,3_prime_UTR_variant | ||||
VEP_impact | MODIFIER | ||||||
cDNA_position | 192-? | ||||||
CDS_position | 188-? | ||||||
Protein_position | 63-? | ||||||
Exon_number | 3-4/4 | ||||||
Interactor | WBInteraction000543190 | ||||||
WBInteraction000543245 | |||||||
Description | Phenotype (12) | ||||||
Phenotype_not_observed | WBPhenotype:0000012 | Paper_evidence | WBPaper00042184 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | "We found that neither deletions in 12 insulins nor knockdown of any of the 40 insulins results in dauers (Fig 1A; Supplemental Table S2)." | Paper_evidence | WBPaper00042184 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000013 | Paper_evidence | WBPaper00042184 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | "After dauer-inducing conditions, all mutants analyzed were capable of forming dauers, indicating that they are not dauer defective (Fig 1B). " | Paper_evidence | WBPaper00042184 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference | WBPaper00041267 | ||||||
WBPaper00043908 | |||||||
WBPaper00042184 | |||||||
WBPaper00048507 | |||||||
Remark | Allele sequenced by Seung-Jae Lee | Curator_confirmed | WBPerson2970 | ||||
Method | KO_consortium_allele |