WormBase Tree Display for Variation: WBVar00094143
expand all nodes | collapse all nodes | view schema
WBVar00094143 | Name | Public_name | ok3062 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F18A1.6b.2:c.453_890delinsGAAAACATTGACAATGGATGATTG | |||||||
CE04406:p.Ser156_Lys294delinsTer | ||||||||
F18A1.6a.1:c.444_881delinsGAAAACATTGACAATGGATGATTG | ||||||||
CE27977:p.Ser159_Lys297delinsTer | ||||||||
F18A1.6b.1:c.453_890delinsGAAAACATTGACAATGGATGATTG | ||||||||
HGVSg | CHROMOSOME_II:g.7661078_7661563delinsCAATCATCCATTGTCAATGTTTTC | |||||||
Sequence_details | SMap | S_parent | Sequence | F18A1 | ||||
Flanking_sequences | gtcatcattccaaatgcatcttcatacttt | gtacttgttgtagcagattcagtcatatat | ||||||
Mapping_target | F18A1 | |||||||
Type_of_mutation | Insertion | CAATCATCCATTGTCAATGTTTTC | ||||||
Deletion | ||||||||
PCR_product | ok3062_external | |||||||
ok3062_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032941 | |||||||
Component_of_genotype | WBGenotype00000077 | |||||||
WBGenotype00000078 | ||||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00017547 | ||||||
Transcript | F18A1.6b.2 (11) | |||||||
F18A1.6a.1 (11) | ||||||||
F18A1.6b.1 (11) | ||||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00044611 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | alfa-1(ok3062) mutants were more sensitive to aldicarb induced paralysis compared to wild type worms (Figure 2B). Authors suggest that alfa-1(ok3062) mutants may haveimpaired inhibitory GABAergic signaling. | Paper_evidence | WBPaper00044611 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Worms treated with 1mM aldicarb. | Paper_evidence | WBPaper00044611 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000636 | Paper_evidence | WBPaper00044611 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | alfa-1(ok3062) mutants have increased neurodegeneration in motor neurons during adulthood. Authors call this age-dependent neurodegeneration. | Paper_evidence | WBPaper00044611 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00044611 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | alfa-1(ok3062) mutants display motility defects causing paralysis in adulthood. Authors call this an age-dependent motility defect. | Paper_evidence | WBPaper00044611 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000876 | Paper_evidence | WBPaper00044611 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | alfa-1(ok3062) mutants were more sensitive to osmotic stress associated lethality compared to N2 worms. | Paper_evidence | WBPaper00044611 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Worms were placed on 400 mM NaCl. | Paper_evidence | WBPaper00044611 | ||||
Curator_confirmed | WBPerson557 | |||||||
Disease_info | Models_disease | DOID:332 | ||||||
Models_disease_in_annotation | WBDOannot00001028 | |||||||
Reference | WBPaper00044611 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |