WormBase Tree Display for Variation: WBVar00094010
expand all nodes | collapse all nodes | view schema
| WBVar00094010 | Name | Public_name | ok2919 | ||||
|---|---|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_III:g.2060893_2061330del | ||||||
| Sequence_details | SMap | S_parent | Sequence | Y39A3A | |||
| Flanking_sequences | agtttcacagaacaacgtttgagctcccgg | ttgccgaaattgaaattttccggcaaatcg | |||||
| Mapping_target | Y39A3A | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | ok2919_external | ||||||
| ok2919_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00032841 | ||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00002099 | |||||
| Transcript | Y39A3A.5.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||
| VEP_impact | MODIFIER | ||||||
| cDNA_position | ?-65 | ||||||
| CDS_position | ?-65 | ||||||
| Protein_position | ?-22 | ||||||
| Exon_number | 1/3 | ||||||
| Interactor (41) | |||||||
| Isolation | Mutagen | EMS | |||||
| Description | Phenotype (17) | ||||||
| Phenotype_not_observed | WBPhenotype:0000012 | Paper_evidence | WBPaper00042184 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Remark | "We found that neither deletions in 12 insulins nor knockdown of any of the 40 insulins results in dauers (Fig 1A; Supplemental Table S2)." | Paper_evidence | WBPaper00042184 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| WBPhenotype:0000013 | Paper_evidence | WBPaper00042184 | |||||
| Curator_confirmed | WBPerson2987 | ||||||
| Remark | "After dauer-inducing conditions, all mutants analyzed were capable of forming dauers, indicating that they are not dauer defective (Fig 1B). " | Paper_evidence | WBPaper00042184 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Reference | WBPaper00043908 | ||||||
| WBPaper00042184 | |||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
