WormBase Tree Display for Variation: WBVar00093858
expand all nodes | collapse all nodes | view schema
WBVar00093858 | Evidence | Paper_evidence | WBPaper00039858 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok2759 | ||||||
HGVSg | CHROMOSOME_III:g.5173267_5173924del | |||||||
Sequence_details | SMap | S_parent | Sequence | K10D2 | ||||
Flanking_sequences | ttaaaatctcagcgggagtttgatcaaatt | cattgggaaagacgaaccgaataataggta | ||||||
Mapping_target | K10D2 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok2759_external | |||||||
ok2759_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00037175 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00019629 | ||||||
WBGene00019630 | ||||||||
WBGene00019631 | ||||||||
Transcript | K10D2.4.1 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2/3 | |||||||
Exon_number | 1-4/4 | |||||||
K10D2.5.1 | VEP_consequence | 3_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 458-? | |||||||
Exon_number | 5/5 | |||||||
K10D2.3.1 | VEP_consequence | 5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-3 | |||||||
Exon_number | 1/14 | |||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0000684 | Paper_evidence | WBPaper00039858 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Sterile hermaphrodites had severely reduced germlines containing a small number of early germ cells and no evidence of undergoing a mitotic-to-meiotic transition. | Paper_evidence | WBPaper00039858 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | unc-42; lon-1 | Paper_evidence | WBPaper00039858 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00039858 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ok2759 deletion homozygotes hatch and develop into sterile (Ste) adults. | Paper_evidence | WBPaper00039858 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | unc-42; lon-1 | Paper_evidence | WBPaper00039858 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000691 | Paper_evidence | WBPaper00039858 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The gonads of emb-1(ok2759) homozygotes failed to completely develop. The gonads exhibited little evidence of either spermatogenesis or oogenesis, and the arms remained linear and failed to reflex toward the dorsal side. | Paper_evidence | WBPaper00039858 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | unc-42; lon-1 | Paper_evidence | WBPaper00039858 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00039858 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ok2759 deletion homozygotes hatch and develop into adults with a protruding vulva (Pvl) phenotype. | Paper_evidence | WBPaper00039858 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | unc-42; lon-1 | Paper_evidence | WBPaper00039858 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00039858 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Both male and hermaphrodites exhibit reduced germlines. | Paper_evidence | WBPaper00039858 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | unc-42; lon-1 | Paper_evidence | WBPaper00039858 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00039858 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |