WormBase Tree Display for Variation: WBVar00093740
expand all nodes | collapse all nodes | view schema
WBVar00093740 | Name | Public_name | ok2625 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F49E10.3.1:c.96-1_*9del | |||||||
HGVSg | CHROMOSOME_X:g.5886077_5886624del | |||||||
Sequence_details | SMap | S_parent | Sequence | F49E10 | ||||
Flanking_sequences | tcctattttttctattttttatatttttca | tgcaaacaccttgattaccaagaacaaaac | ||||||
Mapping_target | F49E10 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok2625_external | |||||||
ok2625_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032674 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001450 | ||||||
Transcript | F49E10.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F49E10.3.1:c.96-1_*9del | |||||||
cDNA_position | ?-545 | |||||||
Intron_number | 2-4/5 | |||||||
Exon_number | 3-6/6 | |||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0000542 | Paper_evidence | WBPaper00043908 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002286 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002287 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002292 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002301 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002312 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0004016 | Paper_evidence | WBPaper00064746 | ||||||
Curator_confirmed | WBPerson40249 | |||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0001524 | Paper_evidence | WBPaper00036308 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | 0% of flp-7(ok2625) animals were resistant to EGF-induced sleep (Table 1) | Paper_evidence | WBPaper00036308 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Animals carrying the hs:LIN-3 transgene were well fed and grown at 20C. Young adult animals were scored 2 hours after heat shock for EGF-induced sleep behavior (see Materials and methods). | Paper_evidence | WBPaper00036308 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Genotype | hs:LIN-3 | Paper_evidence | WBPaper00036308 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002432 | Paper_evidence | WBPaper00050011 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Null mutation of this neuropeptide had little or no effect on stress-induced sleep. To determine whether ALA-enriched neuropeptides are necessary for stress-induced sleep, we assayed locomotion, head movement, pharyngeal pumping, avoidance response, and defecation before and 30 min after heat shock. Single-null mutants were indistinguishable from wild-type with respect to pumping, locomotion, and head movement after heat shock. | Paper_evidence | WBPaper00050011 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00043908 | |||||||
WBPaper00036308 | ||||||||
WBPaper00050011 | ||||||||
WBPaper00064746 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |