WormBase Tree Display for Variation: WBVar00093458
expand all nodes | collapse all nodes | view schema
WBVar00093458 | Name | Public_name | ok2300 | ||||
---|---|---|---|---|---|---|---|
Other_name | CE47965:p.Pro744_Ter1004delinsHisLeuLysAspSerGlu | ||||||
CE48031:p.Pro744_Ter1004delinsHisLeuLysAspSerGlu | |||||||
F11H8.4b.1:c.2231_3011delinsATCTGAAGGATTCCGA | |||||||
F11H8.4a.1:c.2231_3011delinsATCTGAAGGATTCCGA | |||||||
HGVSg | CHROMOSOME_III:g.7025278_7026104delinsTCGGAATCCTTCAGAT | ||||||
Sequence_details | SMap | S_parent | Sequence | F11H8 | |||
Flanking_sequences | ttcaaaaatgttcggaatccttcagatgct | gcgggggtcctccggtgattggaggaagac | |||||
Mapping_target | F11H8 | ||||||
Type_of_mutation | Insertion | TCGGAATCCTTCAGAT | |||||
Deletion | |||||||
PCR_product | OK2300_external | ||||||
OK2300_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00036953 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00000872 | |||||
Transcript | F11H8.4b.1 (11) | ||||||
F11H8.4a.1 (11) | |||||||
Interactor | WBInteraction000534801 | ||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype | WBPhenotype:0000087 | Paper_evidence | WBPaper00041258 | |||
Curator_confirmed | WBPerson3809 | ||||||
Remark | in worms rescued maternally for embryogenesis- thin body-wall muscle cells | Paper_evidence | WBPaper00041258 | ||||
Curator_confirmed | WBPerson3809 | ||||||
WBPhenotype:0000395 | Paper_evidence | WBPaper00041258 | |||||
Curator_confirmed | WBPerson3809 | ||||||
Remark | in worms rescued maternally for embryogenesis- small single-arm gonad with few to no mature gametes. | Paper_evidence | WBPaper00041258 | ||||
Curator_confirmed | WBPerson3809 | ||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00041258 | |||||
Curator_confirmed | WBPerson3809 | ||||||
Remark | in worms rescued maternally for embryogenesis- protruding vulva (Pvl) | Paper_evidence | WBPaper00041258 | ||||
Curator_confirmed | WBPerson3809 | ||||||
WBPhenotype:0001213 | Paper_evidence | WBPaper00041258 | |||||
Curator_confirmed | WBPerson3809 | ||||||
Remark | in worms rescued maternally for embryogenesis- slow body movements | Paper_evidence | WBPaper00041258 | ||||
Curator_confirmed | WBPerson3809 | ||||||
WBPhenotype:0001699 | Paper_evidence | WBPaper00041258 | |||||
Curator_confirmed | WBPerson3809 | ||||||
Remark | in worms rescued maternally for embryogenesis- body immobility in the middle/posterior | Paper_evidence | WBPaper00041258 | ||||
Curator_confirmed | WBPerson3809 | ||||||
WBPhenotype:0001889 | Paper_evidence | WBPaper00047037 | |||||
Curator_confirmed | WBPerson3809 | ||||||
Remark | We examined body-wall muscle sarcomere structure in cyk-1(ok2300) and fhod-1(tm2363) adult hermaphrodites using TEM. Both single mutants and double mutants had sarcomeres that contained thin and thick filaments, but their sarcomeres were smaller than wild-type, and contained fewer thin and thick filaments than wild-type. | Paper_evidence | WBPaper00047037 | ||||
Curator_confirmed | WBPerson3809 | ||||||
WBPhenotype:0001890 | Paper_evidence | WBPaper00047037 | |||||
Curator_confirmed | WBPerson3809 | ||||||
Remark | The dense bodies of cyk-1(ok2300) and fhod-1(tm2363);cyk-1(ok2300) mutants were deficient in electron-dense material. | Paper_evidence | WBPaper00047037 | ||||
Curator_confirmed | WBPerson3809 | ||||||
WBPhenotype:0002207 | Paper_evidence | WBPaper00041258 | |||||
Curator_confirmed | WBPerson3809 | ||||||
Remark | in worms rescued maternally for embryogenesis- small single-arm gonad with few to no mature gametes. | Paper_evidence | WBPaper00041258 | ||||
Curator_confirmed | WBPerson3809 | ||||||
Reference | WBPaper00041258 | ||||||
WBPaper00047037 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |