WormBase Tree Display for Variation: WBVar00093418

WBVar00093418 Name: Public_name: ok2257
    Other_name: F08A8.1a.1:c.951_1393del
      F08A8.1c.1:c.864_1306del
      CE17633:p.Ala318ThrfsTer10
      F08A8.1a.2:c.951_1393del
      CE39570:p.Ala289ThrfsTer10
      F08A8.1b.1:c.615_1057del
      F08A8.1b.2:c.615_1057del
      CE36125:p.Ala206ThrfsTer10
    HGVSg: CHROMOSOME_I:g.12939945_12941008del
  Sequence_details: SMap: S_parent: Sequence: F08A8
    Flanking_sequences: gtatgcgttgaatattgcaacaagatactc cactggtagcctacttgggcgccagaagtg
    Mapping_target: F08A8
    Type_of_mutation: Deletion
    PCR_product: ok2257_external
      ok2257_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036871
    Component_of_genotype: WBGenotype00000155
      WBGenotype00000156
      WBGenotype00000157
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00008564
    Transcript: F08A8.1c.1 (11)
      F08A8.1b.2 (11)
      F08A8.1a.1 (11)
      F08A8.1b.1 (11)
      F08A8.1a.2 (11)
    Interactor: WBInteraction000501311
      WBInteraction000501315
  Isolation: Mutagen: EMS
  Description: Phenotype: WBPhenotype:0000006 Paper_evidence: WBPaper00039810
        Curator_confirmed: WBPerson712
        Remark: After producing 60-70 embryos, F08A8.1 hermaphrodites began to slow in egg-laying and eventually stopped egg-laying resulting in the accumulation of a large number of embryos in the uterus; about 15% of F08A8.1(ok2257) worms showed a "bag-of-worms" phenotype. Paper_evidence: WBPaper00039810
            Curator_confirmed: WBPerson712
      WBPhenotype:0000060 Paper_evidence: WBPaper00039810
        Curator_confirmed: WBPerson712
        Remark: About 28% (N=86) of these animals died as adults. Paper_evidence: WBPaper00039810
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0007833 PATO:0001422 Paper_evidence: WBPaper00039810
                Curator_confirmed: WBPerson712
          Life_stage: WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00039810
                Curator_confirmed: WBPerson712
      WBPhenotype:0000154 Paper_evidence: WBPaper00039810
        Curator_confirmed: WBPerson712
        Remark: (ok2257) mutant animals produced fewer progeny than the wild-type animals. F08A8.1 mutant adult hermaphrodites produced an average of 77 (N=86) viable progenies during their reproductive period, compared to an average of 255 (N=60) viable progenies for wild type in the same period. Paper_evidence: WBPaper00039810
            Curator_confirmed: WBPerson712
      WBPhenotype:0000312 Paper_evidence: WBPaper00046550
        Curator_confirmed: WBPerson22921
      WBPhenotype:0001888 Paper_evidence: WBPaper00039810
        Curator_confirmed: WBPerson712
        Remark: F08A8.1 mutant animals display a 45% increase in fat accumulation in the intestine as compared to the wild type. Paper_evidence: WBPaper00039810
            Curator_confirmed: WBPerson712
      WBPhenotype:0002051 Paper_evidence: WBPaper00040624
        Curator_confirmed: WBPerson712
        Remark: LC-MS/MS analysis of the excretome of acox-1(ok2257) mutant worms revealed that the abundance of the alpha, beta-unsaturated ascr#3, the dominating component of wild-type media, was greatly reduced. Likewise, animals exhibit a build-up of longer chained saturated ascarosides. | Thus production of omega-linked ascr#5 is abolished in acox-1(ok2257) worms, whereas production of longer chain homologues with 5-13-carbon side chains, e.g., oscr#9, is starkly upregulated. Paper_evidence: WBPaper00040624
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00005106 Paper_evidence: WBPaper00040624
              Curator_confirmed: WBPerson712
      WBPhenotype:0002052 Paper_evidence: WBPaper00046550
        Curator_confirmed: WBPerson22921
    Phenotype_not_observed: WBPhenotype:0000030 Paper_evidence: WBPaper00039810
        Curator_confirmed: WBPerson712
        Remark: (ok2257) mutant animals showed normal growth profiles. Paper_evidence: WBPaper00039810
            Curator_confirmed: WBPerson712
      WBPhenotype:0000518 Paper_evidence: WBPaper00039810
        Curator_confirmed: WBPerson712
        Remark: (ok2257) mutant animals showed normal development profiles. Paper_evidence: WBPaper00039810
            Curator_confirmed: WBPerson712
  Reference: WBPaper00039810
    WBPaper00040624
    WBPaper00046550
    WBPaper00062224
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele