WormBase Tree Display for Variation: WBVar00093396
expand all nodes | collapse all nodes | view schema
WBVar00093396 | Name | Public_name | ok2232 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | R10E11.3a.1:c.125_943-29del | |||||||
R10E11.3b.1:c.94-5_907-29del | ||||||||
HGVSg | CHROMOSOME_III:g.9776810_9778249del | |||||||
Sequence_details | SMap | S_parent | Sequence | R10E11 | ||||
Flanking_sequences | ttggaaatacatgttactgcaactcagtga | cgcagcataataatgatcaaattttcagag | ||||||
Mapping_target | R10E11 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok2232_external | |||||||
ok2232_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032438 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00011216 | ||||||
Transcript | R10E11.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | R10E11.3b.1:c.94-5_907-29del | |||||||
Intron_number | 1-5/5 | |||||||
Exon_number | 2-5/6 | |||||||
R10E11.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | R10E11.3a.1:c.125_943-29del | |||||||
cDNA_position | 140-? | |||||||
CDS_position | 125-? | |||||||
Protein_position | 42-? | |||||||
Intron_number | 3-6/7 | |||||||
Exon_number | 3-6/8 | |||||||
Interactor | WBInteraction000569089 | |||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0001278 | Paper_evidence | WBPaper00044602 | ||||
Curator_confirmed | WBPerson10038 | |||||||
Remark | Quoted from paper, "The increase in GLR-1::GFP punctum intensity observed in the VNC of animals overexpressing WDR-20 and WDR-48 (Pglr-1::wdr-20/wdr-48)(Fig. 5,C-E) was partially reduced in the usp-46 null mutant background (D and E). These data reveal that the WDR-20/WDR-48-induced increase in GLR-1::GFP in the VNC is partially dependent on usp-46." | Paper_evidence | WBPaper00044602 | |||||
Curator_confirmed | WBPerson10038 | |||||||
Phenotype_assay | Genotype | nuIs24(Pglr-1::glr-1::GFP) | Paper_evidence | WBPaper00044602 | ||||
Curator_confirmed | WBPerson10038 | |||||||
Reference | WBPaper00044602 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |