WormBase Tree Display for Variation: WBVar00092261
expand all nodes | collapse all nodes | view schema
WBVar00092261 | Name | Public_name | ok990 | ||||
---|---|---|---|---|---|---|---|
Other_name | Y47H9C.2.1:c.689-9_1124+28del | ||||||
HGVSg | CHROMOSOME_I:g.11847035_11847924del | ||||||
Sequence_details | SMap | S_parent | Sequence | Y47H9C | |||
Flanking_sequences | ggtgcggtccacggctggtccctatatatt | actataacaaaaagaaaacaaatacattgt | |||||
Mapping_target | Y47H9C | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | OK990_external | ||||||
OK990_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00031751 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00012948 | |||||
Transcript | Y47H9C.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | Y47H9C.2.1:c.689-9_1124+28del | ||||||
Intron_number | 6-10/11 | ||||||
Exon_number | 7-10/12 | ||||||
Isolation | Mutagen | UV/TMP | |||||
Description | Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00045834 | |||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Table 2, Additional file 13A | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Additional file 12 | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Animals did not show a significant difference in age-related decline of thrashing rate, compared to wild type (N2) controls (Additional file 9) | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001700 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Figure 3 A-B | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001726 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Wild-type N2 animals had an average length of 1222 μm and width of 78 μm (Additional file 6). Mutants for dhhc-2(ok990) showed no significant changes in body length or width. | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001727 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Wild-type N2 animals had an average length of 1222 μm and width of 78 μm (Additional file 6). Mutants for dhhc-2(ok990) showed no significant changes in body length or width. | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Additional file 8 | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference | WBPaper00045834 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |