WormBase Tree Display for Variation: WBVar00092132
expand all nodes | collapse all nodes | view schema
| WBVar00092132 | Evidence | Paper_evidence | WBPaper00026493 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ok857 | |||||
| HGVSg | CHROMOSOME_II:g.14412955_14413569del | ||||||
| Sequence_details | SMap | S_parent | Sequence | F26H11 | |||
| Flanking_sequences | cttcacgaatctggcgaattgtcggaacaa | ttggagggtcgcgtgaaaaaatgagaacat | |||||
| Mapping_target | F26H11 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | ok857_external | ||||||
| ok857_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00031671 | ||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001371 | |||||
| Transcript | F26H11.5.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| cDNA_position | ?-331 | ||||||
| CDS_position | ?-321 | ||||||
| Protein_position | ?-107 | ||||||
| Intron_number | 2/4 | ||||||
| Exon_number | 1-3/5 | ||||||
| Isolation | Mutagen | UV/TMP | |||||
| Description | Phenotype | WBPhenotype:0001274 | Paper_evidence | WBPaper00053051 | |||
| Curator_confirmed | WBPerson1783 | ||||||
| Remark | animal dies faster than wild type under noxious heat condition | Paper_evidence | WBPaper00053051 | ||||
| Curator_confirmed | WBPerson1783 | ||||||
| Phenotype_not_observed | WBPhenotype:0000180 | Paper_evidence | WBPaper00027655 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| Remark | Authors examined cellular structures to which EXL-1 normally localizes, namely neuronal and muscle Golgi, muscle dense bodies, lysosomes in intestinal cells and coloemocytes, and CAN and PVD axon morphology. The morphology of all of these structures appeared normal. | Paper_evidence | WBPaper00027655 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0000704 | Paper_evidence | WBPaper00027655 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| Remark | Authors examined cellular structures to which EXL-1 normally localizes, namely neuronal and muscle Golgi, muscle dense bodies, lysosomes in intestinal cells and coloemocytes, and CAN and PVD axon morphology. The morphology of all of these structures appeared normal. | Paper_evidence | WBPaper00027655 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0001426 | Paper_evidence | WBPaper00027655 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| Remark | Coloemocyte endocytic uptake appeared normal in exl-1(ok857) mutant animals. | Paper_evidence | WBPaper00027655 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0001890 | Paper_evidence | WBPaper00027655 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| Remark | Authors examined cellular structures to which EXL-1 normally localizes, namely neuronal and muscle Golgi, muscle dense bodies, lysosomes in intestinal cells and coloemocytes, and CAN and PVD axon morphology. The morphology of all of these structures appeared normal. | Paper_evidence | WBPaper00027655 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0002096 | Paper_evidence | WBPaper00027655 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| Remark | Authors examined cellular structures to which EXL-1 normally localizes, namely neuronal and muscle Golgi, muscle dense bodies, lysosomes in intestinal cells and coloemocytes, and CAN and PVD axon morphology. The morphology of all of these structures appeared normal. | Paper_evidence | WBPaper00027655 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0002097 | Paper_evidence | WBPaper00027655 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| Remark | Authors examined cellular structures to which EXL-1 normally localizes, namely neuronal and muscle Golgi, muscle dense bodies, lysosomes in intestinal cells and coloemocytes, and CAN and PVD axon morphology. The morphology of all of these structures appeared normal. | Paper_evidence | WBPaper00027655 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0002562 | Paper_evidence | WBPaper00027655 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| Remark | Intestinal lysosome acidification appeared normal in exl-1(ok857) mutant animals. | Paper_evidence | WBPaper00027655 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| Disease_info | Models_disease | DOID:1574 | |||||
| Models_disease_in_annotation | WBDOannot00000653 | ||||||
| Reference | WBPaper00026493 | ||||||
| WBPaper00053051 | |||||||
| WBPaper00027655 | |||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
