WormBase Tree Display for Variation: WBVar00092097
expand all nodes | collapse all nodes | view schema
WBVar00092097 | Evidence | Paper_evidence | WBPaper00032974 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok818 | |||||
Other_name | F26F4.7.1:c.1075_2434del | ||||||
CE29291:p.Tyr360TrpfsTer28 | |||||||
HGVSg | CHROMOSOME_III:g.4895925_4897420del | ||||||
Sequence_details | SMap | S_parent | Sequence | F26F4 | |||
Flanking_sequences | tcccgtcaccgcctttatcgagtaccacat | ttcatcaatgttagactcttgacggattcg | |||||
Mapping_target | F26F4 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok818_external | ||||||
ok818_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00031646 | ||||||
WBStrain00040305 | |||||||
WBStrain00047784 | |||||||
WBStrain00047785 | |||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00003598 | |||||
Transcript | F26F4.7.1 (11) | ||||||
Interactor | WBInteraction000051405 | ||||||
WBInteraction000051407 | |||||||
WBInteraction000051408 | |||||||
WBInteraction000051410 | |||||||
WBInteraction000051411 | |||||||
WBInteraction000503927 | |||||||
WBInteraction000517227 | |||||||
WBInteraction000520821 | |||||||
Isolation | Mutagen | UV/TMP | |||||
Description | Phenotype | WBPhenotype:0000438 | Paper_evidence | WBPaper00032974 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | 3% of nhl-2(0) animals exhibit a retarded heterochronic phenotype; they fail to produce continuous adult-specific cuticular structures (alae) at the L4 molt, and individual seam cells reiterate L2-specific seam cell lineage patterns at the L3 stage | Paper_evidence | WBPaper00032974 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00032974 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00032974 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Removal of nhl-2 activity did not affect vulval or uterine expression of COG-1::GFP | Paper_evidence | WBPaper00032974 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00032974 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001370 | Paper_evidence | WBPaper00032974 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | The physical association of CGH-1 with the core-miRISC components is preserved in nhl-2(0) mutant animals, indicating that binding of CGH-1 to miRISC is not mediated by NHL-2 | Paper_evidence | WBPaper00032974 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00032974 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00032974 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | nhl-2(0) mutations did not affect ASEL fate specification | Paper_evidence | WBPaper00032974 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00032974 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00032974 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |