WormBase Tree Display for Variation: WBVar00092073
expand all nodes | collapse all nodes | view schema
WBVar00092073 | Name | Public_name | ok793 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C16C10.7a.1:c.315+1_316-50delinsACCAC | |||||||
C16C10.7b.1:c.315+1_316-50delinsACCAC | ||||||||
HGVSg | CHROMOSOME_III:g.4165410_4165917delinsGTGGT | |||||||
Sequence_details | SMap | S_parent | Sequence | C16C10 | ||||
Flanking_sequences | attttgttagtttttgggtgtgtgtgtgtt | cggtggtggttcacttcgttgtccttttgg | ||||||
Mapping_target | C16C10 | |||||||
Type_of_mutation | Insertion | GTGGT | ||||||
Deletion | ||||||||
PCR_product | ok793_external | |||||||
ok793_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031634 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004381 | ||||||
Transcript | C16C10.7a.1 | VEP_consequence | splice_donor_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C16C10.7a.1:c.315+1_316-50delinsACCAC | |||||||
Intron_number | 3/5 | |||||||
C16C10.7b.1 | VEP_consequence | splice_donor_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C16C10.7b.1:c.315+1_316-50delinsACCAC | |||||||
Intron_number | 3/6 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 4785 | |||||
Description | Phenotype | WBPhenotype:0001806 | Paper_evidence | WBPaper00041076 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Functional inhibition of other ERAD regulators, including the ER chaperone calreticulin, and the RING finger E3 ubiquitin ligase rnf-5, also weakly stabilized PGP-3(ΔF508) (Table 1; supplementary material Table S2)." | Paper_evidence | WBPaper00041076 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | drSi5 [Cbr-unc-119(+); vha-6p::3XFLAG-pgp-3(CFTR deletion F508)-mCherry::unc-54] | Paper_evidence | WBPaper00041076 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00041076 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |