WormBase Tree Display for Variation: WBVar00092034
expand all nodes | collapse all nodes | view schema
WBVar00092034 | Name | Public_name | ok754 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F42A10.2c.1:c.440_1240del | ||||||||
F42A10.2a.1:c.440_1240del | |||||||||
CE26892:p.His147_Ter414delinsPro | |||||||||
F42A10.2b.1:c.440_1240del | |||||||||
CE01293:p.His147_Ter414delinsPro | |||||||||
CE37913:p.His147_Ter414delinsPro | |||||||||
HGVSg | CHROMOSOME_III:g.6160794_6161835del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F42A10 | |||||
Flanking_sequences | aaatctagtaaaaacgaattaattttcagc | ctctgttgagaatggaacgaaaagctcggg | |||||||
Mapping_target | F42A10 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok754_external | ||||||||
ok754_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035868 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003593 | |||||||
Transcript | F42A10.2c.1 (11) | ||||||||
F42A10.2b.1 (11) | |||||||||
F42A10.2a.1 (11) | |||||||||
Interactor | WBInteraction000537328 | ||||||||
WBInteraction000537329 | |||||||||
WBInteraction000537330 | |||||||||
WBInteraction000537331 | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000059 | Curator_confirmed | WBPerson712 | |||||
Remark | These animals also grew to be sterile adults, indicating that Pmyo-3::nfm-1(+)::gfp expression partially rescued the larval arrest of nfm-1(ok754)M+ animals. | Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00050480 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In nfm-1(ok754)M+, 2/20 QR.a/p daughters failed to migrate anteriorly and stayed near their birthplace, even after QL.a had migrated posteriorly (Figure 3, G and H). | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Rescued_by_transgene | WBTransgene00023701 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00050480 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0003927 | PATO:0000460 | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001140 | Paper_evidence | WBPaper00050480 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Rescued_by_transgene | WBTransgene00023701 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003927 | PATO:0000460 | Paper_evidence | WBPaper00050480 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004096 | PATO:0000460 | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000594 | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No defects were observed in the direction of protrusion. Despite reduced protrusions in nfm-1 mutants, the Q cells completed their anterior and posterior migrations before division (n > 20 for both ok754 and lq132). | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008598 | PATO:0000460 | Paper_evidence | WBPaper00050480 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00050480 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |