WormBase Tree Display for Variation: WBVar00091944
expand all nodes | collapse all nodes | view schema
WBVar00091944 | Evidence | Paper_evidence | WBPaper00031945 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok660 | ||||||
Other_name | E03A3.2.1:c.957-75_1528del | |||||||
HGVSg | CHROMOSOME_III:g.4055071_4056369del | |||||||
Sequence_details | SMap | S_parent | Sequence | E03A3 | ||||
Flanking_sequences | ctcttccagctcttccggcttcttgataat | ttgataaagttttaacaaatgaaattttgg | ||||||
Mapping_target | E03A3 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok660_external | |||||||
ok660_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031548 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004322 | ||||||
Transcript | E03A3.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | E03A3.2.1:c.957-75_1528del | |||||||
cDNA_position | ?-1528 | |||||||
CDS_position | ?-1528 | |||||||
Protein_position | ?-510 | |||||||
Intron_number | 3-5/11 | |||||||
Exon_number | 4-6/12 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype_not_observed | WBPhenotype:0001760 | Paper_evidence | WBPaper00031945 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | MonoG or G-tracts were not deleted at an increased rate as demonstrated by lack of expression of B-galactosidase, which acted as an indicator of a DNA rearrangement bringing a LacZ start codon in-frame with the downstream ORF. No increase in deletion frequency over wild-type was observed for the endogenous qua375 sequence as determined by PCR. At least 24 populations of 5 animals were assayed. | Paper_evidence | WBPaper00031945 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | pkIs2165[pRP1878: hsp-16.41::ATG-(C)23-stops-LacZ unc-119] or pkIs2172 [pRP1889: hsp-16.41::ATG-(monoA)-stops-LacZ unc-119] | Paper_evidence | WBPaper00031945 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031945 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |