WormBase Tree Display for Variation: WBVar00091780
expand all nodes | collapse all nodes | view schema
WBVar00091780 | Name | Public_name | ok492 | ||||
---|---|---|---|---|---|---|---|
Other_name | C07H6.5.1:c.510_*66delinsG | ||||||
HGVSg | CHROMOSOME_III:g.7496196_7497238delinsC | ||||||
Sequence_details | SMap | S_parent | Sequence | C07H6 | |||
Flanking_sequences | gagaacatacacaatctggacgagatcact | cctggggtggcgatgaccaagtgaaccgtt | |||||
Mapping_target | C07H6 | ||||||
Type_of_mutation | Insertion | C | |||||
Deletion | |||||||
PCR_product | ok492_external | ||||||
ok492_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (6) | |||||||
Affects | Gene | WBGene00044945 | |||||
WBGene00000479 | |||||||
Transcript | C07H6.10 | VEP_consequence | transcript_ablation | ||||
VEP_impact | HIGH | ||||||
Exon_number | 1/1 | ||||||
C07H6.5.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C07H6.5.1:c.510_*66delinsG | ||||||
cDNA_position | 548-1397 | ||||||
CDS_position | 510-? | ||||||
Protein_position | 170-? | ||||||
Intron_number | 3-4/5 | ||||||
Exon_number | 3-6/6 | ||||||
Interactor | WBInteraction000051406 | ||||||
WBInteraction000051409 | |||||||
WBInteraction000503743 | |||||||
WBInteraction000503744 | |||||||
WBInteraction000503745 | |||||||
WBInteraction000503746 | |||||||
WBInteraction000503747 | |||||||
WBInteraction000503748 | |||||||
Isolation | Mutagen | UV/TMP | |||||
Genetics | Mapping_data | In_multi_point | 4214 | ||||
Description | Phenotype | WBPhenotype:0000438 | Paper_evidence | WBPaper00032974 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | cgh-1(0) homozygotes (derived from heterozygous mothers) exhibit mild heterochronic phenotypes | Paper_evidence | WBPaper00032974 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00032974 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00040966 | |||||
Curator_confirmed | WBPerson9063 | ||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00026922 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | GFP-LAP:CAR-1 localization severely abnormal in the rachis. | Paper_evidence | WBPaper00026922 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002259 | Paper_evidence | WBPaper00046432 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Mutants exhibit fewer dendritic termini and significantly more secondary and tertiary branches than controls. | Paper_evidence | WBPaper00046432 | ||||
Curator_confirmed | WBPerson712 | ||||||
EQ_annotations (2) | |||||||
Reference | WBPaper00040966 | ||||||
WBPaper00026922 | |||||||
WBPaper00032974 | |||||||
WBPaper00010802 | |||||||
WBPaper00012537 | |||||||
WBPaper00025636 | |||||||
WBPaper00018760 | |||||||
WBPaper00046432 | |||||||
WBPaper00065825 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |