WormBase Tree Display for Variation: WBVar00091740
expand all nodes | collapse all nodes | view schema
WBVar00091740 | Name | Public_name | ok449 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F57C7.3b.1:c.153+113_349del | |||||||
F57C7.3a.1:c.153+113_352del | ||||||||
HGVSg | CHROMOSOME_X:g.10592531_10593013del | |||||||
Sequence_details | SMap | S_parent | Sequence | F57C7 | ||||
Flanking_sequences | aaaagaaaaagccgacacaaaccgctgtag | CATTTGCCGCGCTTCAGATTCGAGCCTGCT | ||||||
Mapping_target | F57C7 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK449_external | |||||||
OK449_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031428 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects (3) | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 4652 | |||||
Description | Phenotype (6) | |||||||
Phenotype_not_observed | WBPhenotype:0000604 | Paper_evidence | WBPaper00026825 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The nervous system is grossly intact in all mutants | Paper_evidence | WBPaper00026825 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026825 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | DiI staining | Paper_evidence | WBPaper00026825 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Genotype | oyIs17, zdIs5, otIs39, evIs82b, rhIs4 | Paper_evidence | WBPaper00026825 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00032446 | |||||||
WBPaper00026825 | ||||||||
WBPaper00024413 | ||||||||
WBPaper00025474 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |