WormBase Tree Display for Variation: WBVar00091705
expand all nodes | collapse all nodes | view schema
WBVar00091705 | Evidence | Paper_evidence | WBPaper00032335 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok411 | ||||||
Other_name | W01C8.6.1:c.956_1154+114del | |||||||
W01C8.6.2:c.956_1154+114del | ||||||||
HGVSg | CHROMOSOME_X:g.5707109_5707537del | |||||||
Sequence_details | SMap | S_parent | Sequence | W01C8 | ||||
Flanking_sequences | tttgaaaaaaaaaacatgtcaatataacgt | ccttagccagttgtttgatgcttgaacctt | ||||||
Mapping_target | W01C8 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK411_external | |||||||
OK411_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031419 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000295 | ||||||
Transcript | W01C8.6.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | W01C8.6.1:c.956_1154+114del | |||||||
cDNA_position | 996-? | |||||||
CDS_position | 956-? | |||||||
Protein_position | 319-? | |||||||
Intron_number | 8-9/12 | |||||||
Exon_number | 8-9/13 | |||||||
W01C8.6.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | W01C8.6.2:c.956_1154+114del | |||||||
cDNA_position | 1055-? | |||||||
CDS_position | 956-? | |||||||
Protein_position | 319-? | |||||||
Intron_number | 9-10/13 | |||||||
Exon_number | 9-10/14 | |||||||
Description | Phenotype | WBPhenotype:0001444 | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited defective gustatory plasticity of NaCl. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl after various pre-treatments: a 15-min wash in CTX buffer with or without 100 mM NaCl (liquid), or 30 min on a CTX plate with or without 100 mM NaCl, and in the presence or absence of bacteria, 500 mM glycerol, or 3 uL of benzaldehyde. | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032335 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |