WormBase Tree Display for Variation: WBVar00091628
expand all nodes | collapse all nodes | view schema
WBVar00091628 | Evidence | Paper_evidence | WBPaper00006306 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok330 | ||||||
Other_name | F53A2.8c.1:c.1086_1425+107del | |||||||
F53A2.8a.1:c.1092_1431+107del | ||||||||
F53A2.8b.1:c.1410_1749+107del | ||||||||
HGVSg | CHROMOSOME_III:g.13353397_13354631del | |||||||
Sequence_details | SMap | S_parent | Sequence | F53A2 | ||||
Flanking_sequences | cccatactaccgtactattcacggatttca | gtgcttgtgccgatttacgggcaattccaa | ||||||
Mapping_target | F53A2 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK330_external | |||||||
OK330_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035548 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003478 | ||||||
Transcript | F53A2.8c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F53A2.8c.1:c.1086_1425+107del | |||||||
cDNA_position | 1106-? | |||||||
CDS_position | 1086-? | |||||||
Protein_position | 362-? | |||||||
Intron_number | 5-7/9 | |||||||
Exon_number | 5-7/10 | |||||||
F53A2.8b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F53A2.8b.1:c.1410_1749+107del | |||||||
cDNA_position | 1427-? | |||||||
CDS_position | 1410-? | |||||||
Protein_position | 470-? | |||||||
Intron_number | 5-7/9 | |||||||
Exon_number | 5-7/10 | |||||||
F53A2.8a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F53A2.8a.1:c.1092_1431+107del | |||||||
cDNA_position | 1112-? | |||||||
CDS_position | 1092-? | |||||||
Protein_position | 364-? | |||||||
Intron_number | 5-7/9 | |||||||
Exon_number | 5-7/10 | |||||||
Interactor | WBInteraction000521868 | |||||||
WBInteraction000521869 | ||||||||
WBInteraction000521870 | ||||||||
WBInteraction000521871 | ||||||||
WBInteraction000521872 | ||||||||
Genetics | Mapping_data | In_multi_point | 4503 | |||||
Description | Phenotype_not_observed | WBPhenotype:0000590 | Paper_evidence | WBPaper00035284 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The appearance of cell corpses was indistinguishable from that in wild-type embryos | Paper_evidence | WBPaper00035284 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000706 | Paper_evidence | WBPaper00025094 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutations did not result in Glo phenotypes | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Staining with LysoTracker Red and acridine orange | Paper_evidence | WBPaper00025094 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0010004 | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Disruption of the FYVE-domain-containing proteins did not cause obvious defects in corpse removal in the germ line | Paper_evidence | WBPaper00031805 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00031805 | |||||||
WBPaper00035284 | ||||||||
WBPaper00025094 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |