WormBase Tree Display for Variation: WBVar00091605
expand all nodes | collapse all nodes | view schema
WBVar00091605 | Evidence | Paper_evidence | WBPaper00006086 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok307 | |||||
Other_name | CE17456:p.Ile112_Ter197delextTer? | ||||||
C24G6.1.1:c.334_591del | |||||||
HGVSg | CHROMOSOME_V:g.5537198_5537498del | ||||||
Sequence_details | SMap | S_parent | Sequence | C24G6 | |||
Flanking_sequences | acaatggagctggcaaattcaatcgaacgt | aaacttctggatttggttgaaacgctcgag | |||||
Mapping_target | C24G6 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok307_external | ||||||
ok307_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00000287 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006376 | |||||
Transcript | C24G6.1.1 (11) | ||||||
Interactor (3) | |||||||
Genetics | Mapping_data | In_multi_point | 4717 | ||||
Description | Phenotype | WBPhenotype:0000775 | Paper_evidence | WBPaper00037842 | |||
Curator_confirmed | WBPerson1950 | ||||||
WBPhenotype:0001370 | Paper_evidence | WBPaper00039957 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Western blot analysis of a wild type precipitate using a SYP-1 antibody revealed a pull down of both SYP-2 and SYP-1. Control IPs with lysates from null mutants did not reveal similar results. | Paper_evidence | WBPaper00039957 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00039957 | ||||||
WBPaper00006086 | |||||||
WBPaper00037842 | |||||||
WBPaper00065003 | |||||||
Remark | ok307 is a I(112)-D(197) deletion | Paper_evidence | WBPaper00006086 | ||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |