WormBase Tree Display for Variation: WBVar00091466
expand all nodes | collapse all nodes | view schema
WBVar00091466 | Evidence | Paper_evidence | WBPaper00005546 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | W04D2 | |||
Flanking_sequences | TGTAGTTTTTGTATATCGTTTACTAAAATTTACTT | CCGAGTTGAAGAGACAGCAAAGTGAGTCTTAGAAC | |||||
Mapping_target | W04D2 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok84_external | ||||||
ok84_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (6) | |||||||
Affects | Gene | WBGene00000228 | |||||
Transcript | W04D2.1b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | W04D2.1b.1:c.870+42_1876del | ||||||
cDNA_position | ?-1881 | ||||||
CDS_position | ?-1876 | ||||||
Protein_position | ?-626 | ||||||
Intron_number | 6/10 | ||||||
Exon_number | 7/11 | ||||||
W04D2.1d.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | W04D2.1d.1:c.657+42_1663del | ||||||
cDNA_position | ?-1663 | ||||||
CDS_position | ?-1663 | ||||||
Protein_position | ?-555 | ||||||
Intron_number | 4/7 | ||||||
Exon_number | 5/8 | ||||||
W04D2.1c.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | W04D2.1c.1:c.735+42_1741del | ||||||
cDNA_position | ?-1741 | ||||||
CDS_position | ?-1741 | ||||||
Protein_position | ?-581 | ||||||
Intron_number | 4/7 | ||||||
Exon_number | 5/8 | ||||||
W04D2.1a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | W04D2.1a.1:c.948+42_1954del | ||||||
cDNA_position | ?-1957 | ||||||
CDS_position | ?-1954 | ||||||
Protein_position | ?-652 | ||||||
Intron_number | 6/10 | ||||||
Exon_number | 7/11 | ||||||
Interactor | WBInteraction000503926 | ||||||
WBInteraction000504326 | |||||||
WBInteraction000519776 | |||||||
WBInteraction000557965 | |||||||
Description | Phenotype | WBPhenotype:0000424 | Paper_evidence | WBPaper00005546 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Pattern of staining is broader that normal with antibody EU102, which was generated against a 352-residue region of (4215-4267) of TTN-1. There is also a loss of the 'dashed' pattern normally seen. | Paper_evidence | WBPaper00005546 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00005546 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000603 | Paper_evidence | WBPaper00005546 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals have nearly normal muscle structure as assayed by polarized light. However, there are extra accumulations of actin and the dense bodies are altered in morphology and distribution as seen by EM. (EM observations were conveyed to authors by R. Barstead.) | Paper_evidence | WBPaper00005546 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00005546 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002587 | Paper_evidence | WBPaper00058750 | |||||
Curator_confirmed | WBPerson43910 | ||||||
Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00005546 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals have near normal locomotion. | Paper_evidence | WBPaper00005546 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00005546 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00005546 | ||||||
WBPaper00058750 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |