WormBase Tree Display for Variation: WBVar00091390
expand all nodes | collapse all nodes | view schema
WBVar00091390 | Evidence | Paper_evidence | WBPaper00025114 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | nr2041 | |||||
Other_name | K10C3.6b.2:c.238+231_669del | ||||||
K10C3.6a.1:c.238+231_672del | |||||||
K10C3.6d.1:c.265+231_699del | |||||||
K10C3.6a.2:c.238+231_672del | |||||||
K10C3.6b.1:c.238+231_669del | |||||||
K10C3.6c.1:c.310+231_744del | |||||||
HGVSg | CHROMOSOME_I:g.9872284_9873176del | ||||||
Sequence_details | SMap | S_parent | Sequence | K10C3 | |||
Flanking_sequences | CCGTAGATTCCATTTCAAAACACGATATTT | TCGATGGAAGATAAGATCATTCTACTGAAA | |||||
Mapping_target | K10C3 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00034504 | ||||||
WBStrain00040338 | |||||||
Laboratory | NS | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003639 | |||||
Transcript | K10C3.6a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | K10C3.6a.1:c.238+231_672del | ||||||
cDNA_position | ?-674 | ||||||
CDS_position | ?-672 | ||||||
Protein_position | ?-224 | ||||||
Intron_number | 3-4/7 | ||||||
Exon_number | 4-5/8 | ||||||
K10C3.6d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | K10C3.6d.1:c.265+231_699del | ||||||
cDNA_position | ?-699 | ||||||
CDS_position | ?-699 | ||||||
Protein_position | ?-233 | ||||||
Intron_number | 3-4/6 | ||||||
Exon_number | 4-5/7 | ||||||
K10C3.6e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
cDNA_position | ?-303 | ||||||
CDS_position | ?-303 | ||||||
Protein_position | ?-101 | ||||||
Intron_number | 1/3 | ||||||
Exon_number | 1-2/4 | ||||||
K10C3.6a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | K10C3.6a.2:c.238+231_672del | ||||||
cDNA_position | ?-810 | ||||||
CDS_position | ?-672 | ||||||
Protein_position | ?-224 | ||||||
Intron_number | 4-5/8 | ||||||
Exon_number | 5-6/9 | ||||||
K10C3.6c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | K10C3.6c.1:c.310+231_744del | ||||||
cDNA_position | ?-744 | ||||||
CDS_position | ?-744 | ||||||
Protein_position | ?-248 | ||||||
Intron_number | 3-4/6 | ||||||
Exon_number | 4-5/7 | ||||||
K10C3.6b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | K10C3.6b.1:c.238+231_669del | ||||||
cDNA_position | ?-671 | ||||||
CDS_position | ?-669 | ||||||
Protein_position | ?-223 | ||||||
Intron_number | 3-4/7 | ||||||
Exon_number | 4-5/8 | ||||||
K10C3.6b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | K10C3.6b.2:c.238+231_669del | ||||||
cDNA_position | ?-808 | ||||||
CDS_position | ?-669 | ||||||
Protein_position | ?-223 | ||||||
Intron_number | 4-5/8 | ||||||
Exon_number | 5-6/9 | ||||||
Interactor (27) | |||||||
Genetics | Interpolated_map_position | I | 3.96514 | ||||
Description | Phenotype (13) | ||||||
Phenotype_not_observed | WBPhenotype:0000138 | Paper_evidence | WBPaper00039781 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The relative content in fatty acid increased in animals, as measured by GC-MS, which is comparable to N2 animals. Fatty acids fed and measured: oleic acid, palmitic acid, stearic acid, and PUFA (arachidonic acid and alpha-linolenic acid). | Paper_evidence | WBPaper00039781 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002087 | Paper_evidence | WBPaper00062603 | |||||
Curator_confirmed | WBPerson38413 | ||||||
Disease_info | Models_disease | DOID:9970 | |||||
Models_disease_in_annotation | WBDOannot00000610 | ||||||
Reference | WBPaper00025114 | ||||||
WBPaper00039781 | |||||||
WBPaper00046499 | |||||||
WBPaper00044077 | |||||||
WBPaper00062224 | |||||||
WBPaper00064979 | |||||||
WBPaper00062603 | |||||||
Method | Deletion_allele |