WormBase Tree Display for Variation: WBVar00091291
expand all nodes | collapse all nodes | view schema
WBVar00091291 | Evidence | Paper_evidence | WBPaper00032966 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | nk3 | |||||||
Other_name | kk3 | Paper_evidence | WBPaper00003454 | ||||||
HGVSg | CHROMOSOME_V:g.6754312_6759906del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T25F10 | |||||
Flanking_sequences | tcctgatcttgacgcggagtctgcgcctcc | gacatgcgggttgaatcttgcgggtgccgg | |||||||
Mapping_target | T25F10 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007207 | ||||||||
WBStrain00007209 | |||||||||
WBStrain00029114 | |||||||||
Laboratory | NU | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000936 | |||||||
WBGene00195421 | |||||||||
WBGene00198350 | |||||||||
Transcript | T25F10.9 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | ||||||||
Exon_number | 1/1 | ||||||||
T25F10.7 | VEP_consequence | transcript_ablation | |||||||
VEP_impact | HIGH | ||||||||
Exon_number | 1/1 | ||||||||
T25F10.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-1215 | ||||||||
CDS_position | ?-1065 | ||||||||
Protein_position | ?-355 | ||||||||
Intron_number | 2-8/9 | ||||||||
Exon_number | 1-9/10 | ||||||||
Interactor | WBInteraction000009115 | ||||||||
WBInteraction000501769 | |||||||||
WBInteraction000523983 | |||||||||
WBInteraction000536169 | |||||||||
Genetics | Interpolated_map_position | V | 0.136731 | ||||||
Description | Phenotype | WBPhenotype:0000062 | Paper_evidence | WBPaper00056577 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | While the wild-type population on S. marcescens survived until all animals ceased laying eggs, all dbl-1(nk3) animals died on S. marcescens by Day 5. | Paper_evidence | WBPaper00056577 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00056577 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Treatment | Animals were age-synchronized by hypochlorite treatment (Stiernagle, 2006) and grown on plates seeded with Escherichia coli OP50. Ten L4 animals were manually transferred to individual plates seeded with S. marcescens. Plates were completely covered by bacteria to prevent animals from avoiding the bacteria. Adults were daily transferred to new plates and the number of eggs laid on each plate was counted every 24 hours until no more eggs were laid. Statistical analyses were performed using repeated measures ANOVA and Tukey's post-hoc test. S. marcescens from Carolina Biological Supply Company. | Paper_evidence | WBPaper00056577 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | NU3 | Paper_evidence | WBPaper00056577 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00005382 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | dbl-1 mutants exhibited a dramatically reduced survival in the presence of Db11 and Db1140 relative to wild-type worms.Mutants showed reduced longevity when grown on OP50. Lifespan increased significantly in the presence of heat-killed OP50 and OP50 plates containing an inhibitor of bacterial replication. | Paper_evidence | WBPaper00005382 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00055320 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | This mutant is more resistant to enterotoxigenic Escherichia coli infection compared with N2 wild-type animals. | Paper_evidence | WBPaper00055320 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Animals grown on plates containing K88plus enterotoxigenic Escherichia coli (ETEC) strain JG280. | Paper_evidence | WBPaper00055320 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0002544 | Paper_evidence | WBPaper00056139 | |||||||
Curator_confirmed | WBPerson3878 | ||||||||
Remark | Normally beneficial Enterobacter cloacae commensal - providing protection from a subsequent Enterococcus faecalis infection turn to pathogenic | Paper_evidence | WBPaper00056139 | ||||||
Curator_confirmed | WBPerson3878 | ||||||||
WBPhenotype:0002545 | Paper_evidence | WBPaper00056577 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | dbl-1 mutant animals laid even fewer eggs than the wild-type animals on S. marcescens, suggesting that the reduced brood size phenotype is independently affected by both S. marcescens exposure and by loss of DBL-1 (p< 0.001).; While the decrease in brood size of wild-type animals on S. epidermidis was not significant (p= 0.115), the decreased brood size of dbl-1(nk3) animals was significant on this pathogenic bacterial strain (p= 0.045).; Wild-type and dbl-1(nk3) animals both significantly decrease their brood size when grown on S. marcescens (p= 0.005 and p< 0.001, respectively). dbl-1 mutant animals laid even fewer eggs than the wild-type animals on S. marcescens, suggesting that the reduced brood size phenotype is independently affected by both S. marcescens exposure and by loss of DBL-1 (p< 0.001). | Paper_evidence | WBPaper00056577 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00056577 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Treatment | Animals were age-synchronized by hypochlorite treatment (Stiernagle, 2006) and grown on plates seeded with Escherichia coli OP50. Ten L4 animals were manually transferred to individual plates seeded with S. marcescens. Plates were completely covered by bacteria to prevent animals from avoiding the bacteria. Adults were daily transferred to new plates and the number of eggs laid on each plate was counted every 24 hours until no more eggs were laid. Statistical analyses were performed using repeated measures ANOVA and Tukey's post-hoc test. S. marcescens from Carolina Biological Supply Company. | Paper_evidence | WBPaper00056577 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | NU3 | Paper_evidence | WBPaper00056577 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002547 | Paper_evidence | WBPaper00056139 | |||||||
Curator_confirmed | WBPerson3878 | ||||||||
Remark | Mutant animals exhibit a greater abundance of bacteria of the Enterobacteriaceae family in the gut, compared to controls. | Paper_evidence | WBPaper00056139 | ||||||
Curator_confirmed | WBPerson3878 | ||||||||
Phenotype_not_observed | WBPhenotype:0000114 | Paper_evidence | WBPaper00035891 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We also tested the role of several other pathways implicated in C. elegans immunity, including the TGF-beta pathway, JNK pathway, the G protein-coupled receptor fshr-1, and the betacatenin homolog bar-1. None of the pathways we tested appeared to be required for induction of irg-1 (see SI Text and Fig S1)." | Paper_evidence | WBPaper00035891 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00049281 | |||||||
Curator_confirmed | WBPerson33350 | ||||||||
Remark | Shorter lifespan when exposed to Mycobacterium marinum, similar to wild-type C. elegans. (Supplemental Figure 11A). Not involved in C. elegans innate immune response against mycobacteria. | Paper_evidence | WBPaper00049281 | ||||||
Curator_confirmed | WBPerson33350 | ||||||||
Increased bagging when exposed to Mycobacterium marinum (~55%), similar to wild-type C. elegans. (Supplemental Figure 11B). Not involved in C. elegans innate immune response against mycobacteria. | Paper_evidence | WBPaper00049281 | |||||||
Curator_confirmed | WBPerson33350 | ||||||||
Increased depigmentation when exposed to Mycobacterium marinum (~30%), similar to wild-type C. elegans. (Supplemental Figure 11C). Not involved in C. elegans innate immune response against mycobacteria. | Paper_evidence | WBPaper00049281 | |||||||
Curator_confirmed | WBPerson33350 | ||||||||
Shorter length when exposed to Mycobacterium marinum (~15%), similar to wild-type C. elegans. (Supplemental Figure 11D). Not involved in C. elegans innate immune response against mycobacteria. | Paper_evidence | WBPaper00049281 | |||||||
Curator_confirmed | WBPerson33350 | ||||||||
EQ_annotations | GO_term | GO:0043473 | PATO:0000460 | Paper_evidence | WBPaper00049281 | ||||
Curator_confirmed | WBPerson33350 | ||||||||
GO:0010171 | PATO:0000460 | Paper_evidence | WBPaper00049281 | ||||||
Curator_confirmed | WBPerson33350 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00049281 | |||||||
Curator_confirmed | WBPerson33350 | ||||||||
Remark | No increased susceptibility to Mycobacterium marinum exposure compared to wild-type C. elegans. (Supplemental Figure 9A,C). Not involved in C. elegans innate immune response against mycobacteria. | Paper_evidence | WBPaper00049281 | ||||||
Curator_confirmed | WBPerson33350 | ||||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00032966 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Abnormally sized mutants did not display enhanced fat accumulation | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Nile Red staining | Paper_evidence | WBPaper00032966 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (11) | |||||||||
Method | Deletion_allele |