WormBase Tree Display for Variation: WBVar00091219
expand all nodes | collapse all nodes | view schema
WBVar00091219 | Evidence | Paper_evidence | WBPaper00029073 | ||
---|---|---|---|---|---|
Name | Public_name | WBVar00091219 | |||
Other_name | niDf198(IV) | ||||
HGVSg | CHROMOSOME_IV:g.14547815_14550314del | ||||
Sequence_details | SMap | S_parent | Sequence | T27E7 | |
Flanking_sequences | TAATTAACTTACCAAATCAAAAACTCTTGG | CTATCTGAAATTACCAGTTTGTAAAATTTT | |||
Mapping_target | T27E7 | ||||
CGH_deleted_probes | ATATGTAAGTTGAGCTCTCACTGACACCTCTTCAGTATTCATGCTCACGA | ATCATATAGTTGTTCAGCCTCAATTTTTGGATCTTTGCCATCGACCAGTT | |||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Natural_variant | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00022850 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Detection_method | Oligo Array CGH | ||||
Status | Live | ||||
Affects | Gene | WBGene00013294 | |||
WBGene00166559 | |||||
WBGene00168987 | |||||
WBGene00012093 | |||||
WBGene00048387 | |||||
WBGene00048535 | |||||
Transcript | Y57G11B.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | 873-? | ||||
CDS_position | 860-? | ||||
Protein_position | 287-? | ||||
Intron_number | 8/9 | ||||
Exon_number | 8-10/10 | ||||
T27E7.27 | |||||
T27E7.46 | |||||
T27E7.52 | |||||
T27E7.26 | |||||
T27E7.9.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
cDNA_position | ?-661 | ||||
CDS_position | ?-639 | ||||
Protein_position | ?-213 | ||||
Intron_number | 2-3/7 | ||||
Exon_number | 1-4/8 | ||||
Reference | WBPaper00029073 | ||||
Remark | Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Original data available on-line at http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE6294. | ||||
Method | CGH_allele |