WormBase Tree Display for Variation: WBVar00090915
expand all nodes | collapse all nodes | view schema
WBVar00090915 | Evidence | Paper_evidence | WBPaper00035439 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n5123 | ||||||
Other_name | Y92C3B.2a.1:c.538_539delinsTT | |||||||
CE27339:p.Thr180Phe | ||||||||
HGVSg | CHROMOSOME_III:g.1072533_1072534delinsAA | |||||||
Sequence_details | SMap | S_parent | Sequence | Y92C3B | ||||
Flanking_sequences | aatttttctcattttttaggcccatcagtg | ttgtcaatcacgtcgtctctacgttggaaa | ||||||
Mapping_target | Y92C3B | |||||||
Type_of_mutation | Substitution | ac | tt | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006697 | ||||||
Transcript | Y92C3B.2a.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | Y92C3B.2a.1:c.538_539delinsTT | |||||||
HGVSp | CE27339:p.Thr180Phe | |||||||
cDNA_position | 538-539 | |||||||
CDS_position | 538-539 | |||||||
Protein_position | 180 | |||||||
Exon_number | 3/8 | |||||||
Codon_change | ACt/TTt | |||||||
Amino_acid_change | T/F | |||||||
Genetics | Interpolated_map_position | III | -24.6736 | |||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00035439 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Viable at 25C | Paper_evidence | WBPaper00035439 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001807 | Paper_evidence | WBPaper00035439 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No apparent effect on the alternative splicing of the unc-93 transcript | Paper_evidence | WBPaper00035439 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | RT PCR | Paper_evidence | WBPaper00035439 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00035439 | |||||||
Method | Substitution_allele |